Closed matsen closed 5 years ago
Here's a motivating picture:
Email sent to Thierry and Aleks:
Dear Aleks and Thierry--
I've been continuing to work with OLGA, which has been a pleasure.
However, there are a couple of things about the default model that seemed surprising to us:
Here we can see that in a pool of a million sequences the default OLGA model generates zero TRB1-6 sequences:
(olga) flyx » olga-generate_sequences --humanTRB -n 1e6 -o olga-1e6.tsv ... (olga) flyx » grep -c 1-6 olga-1e6.tsv 0
And as a positive control, we see lots of 2-7:
(olga) flyx olga/for-france » grep -c 2-7 olga-1e6.tsv 215317
If we look at the OLGA model it does appear in model_params.txt:
%TRBJ1-601;CTCCTATAATTCACCCCTCCACTTTGGGAATGGGACCAGGCTCACTGTGACAG;5 %TRBJ1-602;CTCCTATAATTCACCCCTCCACTTTGGGAACGGGACCAGGCTCACTGTGACAG;6
However, if we understand the model format correctly the 01 allele gets zero probability:
%0,0,0
%0.757297,6.26266e-06,0.242697
OLGA assigns zero probability to CASSEGYEQYV TRBV2 TRBJ2-7:
(olga) flyx ~ » cat 02.tsv
CASSEGYEQYV TRBV2 TRBJ2-7
(olga) flyx ~ » olga-compute_pgen --human_T_beta -i 02.tsv
CASSEGYEQYV 0.0
This is a TCRB that should have high probability if you acknowledge the 02 allele that ends with YV, which isn't a rare allele.
As a positive control, we can see that the version using the 01 allele does have high probability:
(olga) flyx ~ » cat 01.tsv
CASSEGYEQYF TRBV2 TRBJ2-7
(olga) flyx ~ » olga-compute_pgen --human_T_beta -i 01.tsv
CASSEGYEQYF 2.4370209357248395e-06
The 02 allele does appear in model_params.txt:
%TRBJ2-7*02;CTCCTACGAGCAGTACGTCGGGCCGGGCACCAGGCTCACGGTCACAG;14
And in model_marginals.txt 14 gets a reasonable probability:
%0.070029,0.0827931,0.847178
however, it's not in the anchors file (in fact, no secondary allele is present in the anchor file).
Can you help us out on this front?
Thank you for your patience,
Erick
TRBJ1-6 just gets lower than expected Pgen, while most of the time TRBJ2-7 seems normal but sometimes gets zero Pgen.