search

maximilianh / crisporWebsite

All source code of the crispor.org website
http://crispor.org
Other
68 stars 43 forks source link

Errors running local installation #22

Closed genya closed 5 years ago

genya commented 5 years ago

Hi there, I'm posting to ask for help with errors encountered trying to run CRISPOR locally. Please let me know if you have any ideas how to troubleshoot this. Any help would be greatly appreciated!

I do not have root/sudo privileges (running this on a server with python3 default) so installed CRISPOR using a virtual environment as follows:

$git clone https://github.com/maximilianh/crisporWebsite $virtualenv --python=python2.7 crisporWebsite $cd crisporWebsite $source activate (crisporWebsite)$pip install biopython numpy==1.14.0 scikit-learn==0.16.1 pandas twobitreader matplotlib scipy pytabix xlwt (crisporWebsite)$ mv genomes.sample/ genomes/

All of which seemed to work without issue. I then tried the test and got:

(crisporWebsite)$ mkdir -p sampleFiles/mine/ (crisporWebsite)$ python crispor.py sacCer3 sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o sampleFiles/mine/sample.sacCer3.mine.offs.tsv

INFO:root: * running on sequence 'testSeq', guideLen=20, seqLen=182 Traceback (most recent call last): File "crispor.py", line 8003, in main() File "crispor.py", line 8001, in main mainCommandLine() File "crispor.py", line 7807, in mainCommandLine batchId, position, extSeq = newBatch(seqId, seq, org, pamPat, skipAlign) File "crispor.py", line 4054, in newBatch chrom, start, end, strand = findBestMatch(org, seq, batchId) File "crispor.py", line 6495, in findBestMatch remoteAddr = pipes.quote(os.environ["REMOTE_ADDR"]) File "/lab/solexa_sabatini/genya/crispor/lib/python2.7/UserDict.py", line 23, in getitem raise KeyError(key) KeyError: 'REMOTE_ADDR'

Turning on the test and debugging options produced:

(crisporWebsite)$ python crispor.py -td sacCer3 sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o sampleFiles/mine/sample.sacCer3.mine.offs.tsv

File "crispor.py", line 1908, in main.calcCfdScore Failed example: calcCfdScore("GGGGGGGGGGGGGGGGGGGGGGG", "aaaaGaGaGGGGGGGGGGGGGGG") Expected: 0.5140384614450001

mismatches: * !!

Got: 0.5140384614450001

File "crispor.py", line 1918, in main.calcCfdScore Failed example: calcCfdScore("ATGTGGAGATTGCCACCTACCGG", "ATCTGGAGATTGCCACCTACAGG") Expected nothing Got: 0.384615385

File "crispor.py", line 952, in main.findPams Failed example: findPams("TTTNCCCCCCCCCCCCCCCCCTTTN", "TTTN", "+", {}, set()) Expected: ({0: '+'}, set([3])) Got: ({21: '+'}, set([25]))

File "crispor.py", line 956, in main.findPams Failed example: findPams("AAACCCCCCCCCCCCCCCCCCCCC", "NAA", "-", {}, set()) Expected: ({}, set([])) Got: ({0: '-'}, set([3]))

2 items had failures: 2 of 6 in main.calcCfdScore 2 of 9 in main.findPams Test Failed 4 failures.

maximilianh commented 5 years ago

This is my fault. I fixed this a few days ago but may have not pushed it. I’m not at my computer right now but will push as soon as I’m back. Thanks !

On Tue, Dec 25, 2018 at 10:58 PM Evgeni Frenkel notifications@github.com wrote:

Hi there, I'm posting to ask for help with errors encountered trying to run CRISPOR locally. Please let me know if you have any ideas how to troubleshoot this. Any help would be greatly appreciated!

I do not have root/sudo privileges (running this on a server with python3 default) so installed CRISPOR using a virtual environment as follows:

$git clone https://github.com/maximilianh/crisporWebsite $virtualenv --python=python2.7 crisporWebsite $cd crisporWebsite $source activate (crisporWebsite)$pip install biopython numpy==1.14.0 scikit-learn==0.16.1 pandas twobitreader matplotlib scipy pytabix xlwt (crisporWebsite)$ mv genomes.sample/ genomes/

All of which seemed to work without issue. I then tried the test and got:

(crisporWebsite)$ mkdir -p sampleFiles/mine/ (crisporWebsite)$ python crispor.py sacCer3 sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o sampleFiles/mine/sample.sacCer3.mine.offs.tsv

INFO:root: running on sequence 'testSeq', guideLen=20, seqLen=182 Traceback (most recent call last): File "crispor.py", line 8003, in main() File "crispor.py", line 8001, in main mainCommandLine() File "crispor.py", line 7807, in mainCommandLine batchId, position, extSeq = newBatch(seqId, seq, org, pamPat, skipAlign) File "crispor.py", line 4054, in newBatch chrom, start, end, strand = findBestMatch(org, seq, batchId) File "crispor.py", line 6495, in findBestMatch remoteAddr = pipes.quote(os.environ["REMOTE_ADDR"]) File "/lab/solexa_sabatini/genya/crispor/lib/python2.7/UserDict.py", line 23, in getitem* raise KeyError(key) KeyError: 'REMOTE_ADDR'

Turning on the test and debugging options produced:

(crisporWebsite)$ python crispor.py -td sacCer3 sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o sampleFiles/mine/sample.sacCer3.mine.offs.tsv

File "crispor.py", line 1908, in main.calcCfdScore Failed example: calcCfdScore("GGGGGGGGGGGGGGGGGGGGGGG", "aaaaGaGaGGGGGGGGGGGGGGG") Expected: 0.5140384614450001

mismatches: * !!

Got: 0.5140384614450001

File "crispor.py", line 1918, in main.calcCfdScore Failed example: calcCfdScore("ATGTGGAGATTGCCACCTACCGG", "ATCTGGAGATTGCCACCTACAGG") Expected nothing Got: 0.384615385

File "crispor.py", line 952, in main.findPams Failed example: findPams("TTTNCCCCCCCCCCCCCCCCCTTTN", "TTTN", "+", {}, set()) Expected: ({0: '+'}, set([3])) Got: ({21: '+'}, set([25]))

File "crispor.py", line 956, in main.findPams Failed example: findPams("AAACCCCCCCCCCCCCCCCCCCCC", "NAA", "-", {}, set()) Expected: ({}, set([])) Got: ({0: '-'}, set([3]))

2 items had failures: 2 of 6 in main.calcCfdScore 2 of 9 in main.findPams Test Failed 4 failures.

— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22, or mute the thread https://github.com/notifications/unsubscribe-auth/AAS-Teg8RgKZSWsLkajsyrgfvlAbureQks5u8p9tgaJpZM4ZhOkt .

genya commented 5 years ago

Ok, sounds great, thank you! Hope you’re enjoying holidays!

On Wed, Dec 26, 2018 at 8:10 AM Maximilian Haeussler < notifications@github.com> wrote:

This is my fault. I fixed this a few days ago but may have not pushed it. I’m not at my computer right now but will push as soon as I’m back. Thanks !

On Tue, Dec 25, 2018 at 10:58 PM Evgeni Frenkel notifications@github.com wrote:

Hi there, I'm posting to ask for help with errors encountered trying to run CRISPOR locally. Please let me know if you have any ideas how to troubleshoot this. Any help would be greatly appreciated!

I do not have root/sudo privileges (running this on a server with python3 default) so installed CRISPOR using a virtual environment as follows:

$git clone https://github.com/maximilianh/crisporWebsite $virtualenv --python=python2.7 crisporWebsite $cd crisporWebsite $source activate (crisporWebsite)$pip install biopython numpy==1.14.0 scikit-learn==0.16.1 pandas twobitreader matplotlib scipy pytabix xlwt (crisporWebsite)$ mv genomes.sample/ genomes/

All of which seemed to work without issue. I then tried the test and got:

(crisporWebsite)$ mkdir -p sampleFiles/mine/ (crisporWebsite)$ python crispor.py sacCer3 sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o sampleFiles/mine/sample.sacCer3.mine.offs.tsv

INFO:root: running on sequence 'testSeq', guideLen=20, seqLen=182 Traceback (most recent call last): File "crispor.py", line 8003, in main() File "crispor.py", line 8001, in main mainCommandLine() File "crispor.py", line 7807, in mainCommandLine batchId, position, extSeq = newBatch(seqId, seq, org, pamPat, skipAlign) File "crispor.py", line 4054, in newBatch chrom, start, end, strand = findBestMatch(org, seq, batchId) File "crispor.py", line 6495, in findBestMatch remoteAddr = pipes.quote(os.environ["REMOTE_ADDR"]) File "/lab/solexa_sabatini/genya/crispor/lib/python2.7/UserDict.py", line 23, in getitem* raise KeyError(key) KeyError: 'REMOTE_ADDR'

Turning on the test and debugging options produced:

(crisporWebsite)$ python crispor.py -td sacCer3 sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o sampleFiles/mine/sample.sacCer3.mine.offs.tsv

File "crispor.py", line 1908, in main.calcCfdScore Failed example: calcCfdScore("GGGGGGGGGGGGGGGGGGGGGGG", "aaaaGaGaGGGGGGGGGGGGGGG") Expected: 0.5140384614450001

mismatches: * !!

Got: 0.5140384614450001

File "crispor.py", line 1918, in main.calcCfdScore Failed example: calcCfdScore("ATGTGGAGATTGCCACCTACCGG", "ATCTGGAGATTGCCACCTACAGG") Expected nothing Got: 0.384615385

File "crispor.py", line 952, in main.findPams Failed example: findPams("TTTNCCCCCCCCCCCCCCCCCTTTN", "TTTN", "+", {}, set()) Expected: ({0: '+'}, set([3])) Got: ({21: '+'}, set([25]))

File "crispor.py", line 956, in main.findPams Failed example: findPams("AAACCCCCCCCCCCCCCCCCCCCC", "NAA", "-", {}, set()) Expected: ({}, set([])) Got: ({0: '-'}, set([3]))

2 items had failures: 2 of 6 in main.calcCfdScore 2 of 9 in main.findPams Test Failed 4 failures.

— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22, or mute the thread < https://github.com/notifications/unsubscribe-auth/AAS-Teg8RgKZSWsLkajsyrgfvlAbureQks5u8p9tgaJpZM4ZhOkt

.

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-449964738, or mute the thread https://github.com/notifications/unsubscribe-auth/AAMV5lM4Lo0YwVUrcV92d7g4gAnAyHddks5u83U6gaJpZM4ZhOkt .

-- -- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

maximilianh commented 5 years ago

I've pushed the change, sorry for the delay. If you do a git pull this should be solved. Let me know if it isn't.

happy holidays! Max

On Wed, Dec 26, 2018 at 3:15 PM Evgeni Frenkel notifications@github.com wrote:

Ok, sounds great, thank you! Hope you’re enjoying holidays!

On Wed, Dec 26, 2018 at 8:10 AM Maximilian Haeussler < notifications@github.com> wrote:

This is my fault. I fixed this a few days ago but may have not pushed it. I’m not at my computer right now but will push as soon as I’m back. Thanks !

On Tue, Dec 25, 2018 at 10:58 PM Evgeni Frenkel < notifications@github.com> wrote:

Hi there, I'm posting to ask for help with errors encountered trying to run CRISPOR locally. Please let me know if you have any ideas how to troubleshoot this. Any help would be greatly appreciated!

I do not have root/sudo privileges (running this on a server with python3 default) so installed CRISPOR using a virtual environment as follows:

$git clone https://github.com/maximilianh/crisporWebsite $virtualenv --python=python2.7 crisporWebsite $cd crisporWebsite $source activate (crisporWebsite)$pip install biopython numpy==1.14.0 scikit-learn==0.16.1 pandas twobitreader matplotlib scipy pytabix xlwt (crisporWebsite)$ mv genomes.sample/ genomes/

All of which seemed to work without issue. I then tried the test and got:

(crisporWebsite)$ mkdir -p sampleFiles/mine/ (crisporWebsite)$ python crispor.py sacCer3 sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o sampleFiles/mine/sample.sacCer3.mine.offs.tsv

INFO:root: running on sequence 'testSeq', guideLen=20, seqLen=182 Traceback (most recent call last): File "crispor.py", line 8003, in main() File "crispor.py", line 8001, in main mainCommandLine() File "crispor.py", line 7807, in mainCommandLine batchId, position, extSeq = newBatch(seqId, seq, org, pamPat, skipAlign) File "crispor.py", line 4054, in newBatch chrom, start, end, strand = findBestMatch(org, seq, batchId) File "crispor.py", line 6495, in findBestMatch remoteAddr = pipes.quote(os.environ["REMOTE_ADDR"]) File "/lab/solexa_sabatini/genya/crispor/lib/python2.7/UserDict.py", line 23, in getitem* raise KeyError(key) KeyError: 'REMOTE_ADDR'

Turning on the test and debugging options produced:

(crisporWebsite)$ python crispor.py -td sacCer3 sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o sampleFiles/mine/sample.sacCer3.mine.offs.tsv

File "crispor.py", line 1908, in main.calcCfdScore Failed example: calcCfdScore("GGGGGGGGGGGGGGGGGGGGGGG", "aaaaGaGaGGGGGGGGGGGGGGG") Expected: 0.5140384614450001

mismatches: * !!

Got: 0.5140384614450001

File "crispor.py", line 1918, in main.calcCfdScore Failed example: calcCfdScore("ATGTGGAGATTGCCACCTACCGG", "ATCTGGAGATTGCCACCTACAGG") Expected nothing Got: 0.384615385

File "crispor.py", line 952, in main.findPams Failed example: findPams("TTTNCCCCCCCCCCCCCCCCCTTTN", "TTTN", "+", {}, set()) Expected: ({0: '+'}, set([3])) Got: ({21: '+'}, set([25]))

File "crispor.py", line 956, in main.findPams Failed example: findPams("AAACCCCCCCCCCCCCCCCCCCCC", "NAA", "-", {}, set()) Expected: ({}, set([])) Got: ({0: '-'}, set([3]))

2 items had failures: 2 of 6 in main.calcCfdScore 2 of 9 in main.findPams Test Failed 4 failures.

— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22, or mute the thread <

https://github.com/notifications/unsubscribe-auth/AAS-Teg8RgKZSWsLkajsyrgfvlAbureQks5u8p9tgaJpZM4ZhOkt

.

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub < https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-449964738 , or mute the thread < https://github.com/notifications/unsubscribe-auth/AAMV5lM4Lo0YwVUrcV92d7g4gAnAyHddks5u83U6gaJpZM4ZhOkt

.

--

Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

— You are receiving this because you commented. Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-449972382, or mute the thread https://github.com/notifications/unsubscribe-auth/AAS-TdHPouSBZbYrD6nt1E-g4jSmUTApks5u84SFgaJpZM4ZhOkt .

genya commented 5 years ago

Thank you! The test now produces the expected outputs $ python crispor.py sacCer3 > sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o > sampleFiles/mine/sample.sacCer3.mine.offs.tsv

except for the warnings:

INFO:root:Progress x50sPGMoTvUagv3zWjGg - effScores - Calculating guide efficiency scores /crisporWebsite/bin/Azimuth-2.0/azimuth/features/featurization.py:144: FutureWarning: Sorting because non-concatenation axis is not aligned. A future version of pandas will change to not sort by default. To accept the future behavior, pass 'sort=False'. To retain the current behavior and silence the warning, pass 'sort=True'.

Not sure if it matters, but the same errors as before arise if debugging options included: $ python crispor.py -td sacCer3 sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o sampleFiles/mine/sample.sacCer3.mine.offs.tsv

File "crispor.py", line 1913, in main.calcCfdScore Failed example: calcCfdScore("GGGGGGGGGGGGGGGGGGGGGGG", "aaaaGaGaGGGGGGGGGGGGGGG") Expected: 0.5140384614450001

mismatches: * !!

Got: 0.5140384614450001

File "crispor.py", line 1923, in main.calcCfdScore Failed example: calcCfdScore("ATGTGGAGATTGCCACCTACCGG", "ATCTGGAGATTGCCACCTACAGG") Expected nothing Got: 0.384615385

File "crispor.py", line 956, in main.findPams Failed example: findPams("TTTNCCCCCCCCCCCCCCCCCTTTN", "TTTN", "+", {}, set()) Expected: ({0: '+'}, set([3])) Got: ({21: '+'}, set([25]))

File "crispor.py", line 960, in main.findPams Failed example: findPams("AAACCCCCCCCCCCCCCCCCCCCC", "NAA", "-", {}, set()) Expected: ({}, set([])) Got: ({0: '-'}, set([3]))

2 items had failures: 2 of 6 in main.calcCfdScore 2 of 9 in main.findPams Test Failed 4 failures.

maximilianh commented 5 years ago

Yes the warning is triggered by a new version of the pandas package used by a scoring function that I import from one of the authors of these scoring models. I won’t change their code. We can try to find a way to switch off the warning.

As for the -t option, it’s possible that right now one of the tests don’t work anymore, thanks for pointing this out, but it’s nothing serious I’m sure, the results look good, I have to look at how the testing is done.

On Thu, Dec 27, 2018 at 7:23 AM Evgeni Frenkel notifications@github.com wrote:

Thank you! The test now produces the expected outputs $ python crispor.py sacCer3 > sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o > sampleFiles/mine/sample.sacCer3.mine.offs.tsv

except for the warnings:

INFO:root:Progress x50sPGMoTvUagv3zWjGg - effScores - Calculating guide efficiency scores /crisporWebsite/bin/Azimuth-2.0/azimuth/features/featurization.py:144: FutureWarning: Sorting because non-concatenation axis is not aligned. A future version of pandas will change to not sort by default. To accept the future behavior, pass 'sort=False'. To retain the current behavior and silence the warning, pass 'sort=True'.

Not sure if it matters, but the same errors as before arise if debugging options included: $ python crispor.py -td sacCer3 sampleFiles/in/sample.sacCer3.fa sampleFiles/mine/sample.sacCer3.tsv -o sampleFiles/mine/sample.sacCer3.mine.offs.tsv

File "crispor.py", line 1913, in main.calcCfdScore Failed example: calcCfdScore("GGGGGGGGGGGGGGGGGGGGGGG", "aaaaGaGaGGGGGGGGGGGGGGG") Expected: 0.5140384614450001

mismatches: * !!

Got: 0.5140384614450001

File "crispor.py", line 1923, in main.calcCfdScore Failed example: calcCfdScore("ATGTGGAGATTGCCACCTACCGG", "ATCTGGAGATTGCCACCTACAGG") Expected nothing Got: 0.384615385

File "crispor.py", line 956, in main.findPams Failed example: findPams("TTTNCCCCCCCCCCCCCCCCCTTTN", "TTTN", "+", {}, set()) Expected: ({0: '+'}, set([3])) Got: ({21: '+'}, set([25]))

File "crispor.py", line 960, in main.findPams Failed example: findPams("AAACCCCCCCCCCCCCCCCCCCCC", "NAA", "-", {}, set()) Expected: ({}, set([])) Got: ({0: '-'}, set([3]))

2 items had failures: 2 of 6 in main.calcCfdScore 2 of 9 in main.findPams Test Failed 4 failures.

— You are receiving this because you commented.

Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450084692, or mute the thread https://github.com/notifications/unsubscribe-auth/AAS-TQXdtrOn6nLZyZ1jE92ggaQIkt4-ks5u9GdHgaJpZM4ZhOkt .

genya commented 5 years ago

yes it works on my test cases as well. Thank you!

maximilianh commented 5 years ago

I see that you're using FlashFry now. If you're designing libraries, then crispor is probably not the best tool and flashfry may indeed be the more appropriate one.

genya commented 5 years ago

Yes I'm trying both tools for the purpose of genome-wide library design. FlashFry is faster but (as far as I can tell) only outputs statistics on guide specificity and does not list the specific potential off-target sites for each guide, which CRISPOR does and is something we'd like to include for the library. I downloaded CRISPOR guide track of UCSC and didn’t see these off target sites annotated.

Something I noticed that may be of interest is that the guide specificity calculation currently doesn’t take into account the pseudoautosomal status of certain genes on the X and Y chromosomes. All guides for these genes are treated as non-specific because the exact sequence is detected on another chromosome, but in these special cases these identical sequences correspond to the same gene.

On Sat, Dec 29, 2018 at 7:17 AM Maximilian Haeussler < notifications@github.com> wrote:

I see that you're using FlashFry now. If you're designing libraries, then crispor is probably not the best tool and flashfry may indeed be the more appropriate one.

— You are receiving this because you modified the open/close state.

Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450488969, or mute the thread https://github.com/notifications/unsubscribe-auth/AAMV5r_aFfbTEWc5Bojf_g94UtXSK0lrks5u911ugaJpZM4ZhOkt .

-- -- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

maximilianh commented 5 years ago

Hi Evgeni,

the off-target information is contained in a second file, crisprDetails.tab. The format is documented in the crispr track docs page: http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&c=chr1&g=crispr

"pseudoautosomal status": Currently, if there is an exact match on a chromosome, I ignore matches on *_alt chromosomes. This addresses regions with _alt names because they do not appear in the same cell. But that's not your question.

I'm not sure how PARs should be handled, it seems like my current treatment is OK. You think the other match should be ignored? But someone who modifies these regions certainly knows that they are in a PAR region, wouldn't they? Isn't it correct to treat these regions as off-targets, because the other location really is an off-target, as it's on a different chromosome? If I don't show these off-targets, wouldn't people erroneously think they're in the clear, even though they have to be careful with these guides and check the other chromosome for editing?

On Sun, Dec 30, 2018 at 4:09 PM Evgeni Frenkel notifications@github.com wrote:

Yes I'm trying both tools for the purpose of genome-wide library design. FlashFry is faster but (as far as I can tell) only outputs statistics on guide specificity and does not list the specific potential off-target sites for each guide, which CRISPOR does and is something we'd like to include for the library. I downloaded CRISPOR guide track of UCSC and didn’t see these off target sites annotated.

Something I noticed that may be of interest is that the guide specificity calculation currently doesn’t take into account the pseudoautosomal status of certain genes on the X and Y chromosomes. All guides for these genes are treated as non-specific because the exact sequence is detected on another chromosome, but in these special cases these identical sequences correspond to the same gene.

On Sat, Dec 29, 2018 at 7:17 AM Maximilian Haeussler < notifications@github.com> wrote:

I see that you're using FlashFry now. If you're designing libraries, then crispor is probably not the best tool and flashfry may indeed be the more appropriate one.

— You are receiving this because you modified the open/close state.

Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450488969, or mute the thread https://github.com/notifications/unsubscribe-auth/AAMV5r_aFfbTEWc5Bojf_g94UtXSK0lrks5u911ugaJpZM4ZhOkt .

--

Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

— You are receiving this because you commented. Reply to this email directly, view it on GitHub, or mute the thread.

maximilianh commented 5 years ago

Oh, I see the info about the details was missing on the hg38 page of the crispr track! Thanks! I've updated the track now, the change should be visible when Santa Cruz is back at work.

in the meantime, please refer to the hg19 track docs page (or ask me).

On Mon, Dec 31, 2018 at 2:23 PM Maximilian Haeussler maximilianh@gmail.com wrote:

Hi Evgeni,

the off-target information is contained in a second file, crisprDetails.tab. The format is documented in the crispr track docs page: http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&c=chr1&g=crispr

"pseudoautosomal status": Currently, if there is an exact match on a chromosome, I ignore matches on *_alt chromosomes. This addresses regions with _alt names because they do not appear in the same cell. But that's not your question.

I'm not sure how PARs should be handled, it seems like my current treatment is OK. You think the other match should be ignored? But someone who modifies these regions certainly knows that they are in a PAR region, wouldn't they? Isn't it correct to treat these regions as off-targets, because the other location really is an off-target, as it's on a different chromosome? If I don't show these off-targets, wouldn't people erroneously think they're in the clear, even though they have to be careful with these guides and check the other chromosome for editing?

On Sun, Dec 30, 2018 at 4:09 PM Evgeni Frenkel notifications@github.com wrote:

Yes I'm trying both tools for the purpose of genome-wide library design. FlashFry is faster but (as far as I can tell) only outputs statistics on guide specificity and does not list the specific potential off-target sites for each guide, which CRISPOR does and is something we'd like to include for the library. I downloaded CRISPOR guide track of UCSC and didn’t see these off target sites annotated.

Something I noticed that may be of interest is that the guide specificity calculation currently doesn’t take into account the pseudoautosomal status of certain genes on the X and Y chromosomes. All guides for these genes are treated as non-specific because the exact sequence is detected on another chromosome, but in these special cases these identical sequences correspond to the same gene.

On Sat, Dec 29, 2018 at 7:17 AM Maximilian Haeussler < notifications@github.com> wrote:

I see that you're using FlashFry now. If you're designing libraries, then crispor is probably not the best tool and flashfry may indeed be the more appropriate one.

— You are receiving this because you modified the open/close state.

Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450488969, or mute the thread https://github.com/notifications/unsubscribe-auth/AAMV5r_aFfbTEWc5Bojf_g94UtXSK0lrks5u911ugaJpZM4ZhOkt .

--

Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

— You are receiving this because you commented. Reply to this email directly, view it on GitHub, or mute the thread.

genya commented 5 years ago

Hi Maximilian,

Thanks for sending the link to the crispr-details file!

Regarding pseudoautosomal genes, X and Y are of course different chromosomes but the pseudoautosomal regions behave as if they belong to the same chromosome, including recombination during meiosis, so it makes most sense to treat the X and Y copies as different alleles of the same gene. Trying to target the Y copy and not X copy of a PAR gene is like trying to target paternal and not maternal allele of an autosomal gene. There are only ~25 PAR genes, and I agree that any user targeting them should be aware that they can violate otherwise-sensible assumptions of a specificity score, but automated work (such as I'm doing) using the UCSC tracks can run in to trouble with these genes because their guides get labeled with the note, "This guide sequence is not unique in the genome. The specificity scores were not determined."

Best, Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Mon, Dec 31, 2018 at 8:24 AM Maximilian Haeussler < notifications@github.com> wrote:

Hi Evgeni,

the off-target information is contained in a second file, crisprDetails.tab. The format is documented in the crispr track docs page: http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&c=chr1&g=crispr

"pseudoautosomal status": Currently, if there is an exact match on a chromosome, I ignore matches on *_alt chromosomes. This addresses regions with _alt names because they do not appear in the same cell. But that's not your question.

I'm not sure how PARs should be handled, it seems like my current treatment is OK. You think the other match should be ignored? But someone who modifies these regions certainly knows that they are in a PAR region, wouldn't they? Isn't it correct to treat these regions as off-targets, because the other location really is an off-target, as it's on a different chromosome? If I don't show these off-targets, wouldn't people erroneously think they're in the clear, even though they have to be careful with these guides and check the other chromosome for editing?

On Sun, Dec 30, 2018 at 4:09 PM Evgeni Frenkel notifications@github.com wrote:

Yes I'm trying both tools for the purpose of genome-wide library design. FlashFry is faster but (as far as I can tell) only outputs statistics on guide specificity and does not list the specific potential off-target sites for each guide, which CRISPOR does and is something we'd like to include for the library. I downloaded CRISPOR guide track of UCSC and didn’t see these off target sites annotated.

Something I noticed that may be of interest is that the guide specificity calculation currently doesn’t take into account the pseudoautosomal status of certain genes on the X and Y chromosomes. All guides for these genes are treated as non-specific because the exact sequence is detected on another chromosome, but in these special cases these identical sequences correspond to the same gene.

On Sat, Dec 29, 2018 at 7:17 AM Maximilian Haeussler < notifications@github.com> wrote:

I see that you're using FlashFry now. If you're designing libraries, then crispor is probably not the best tool and flashfry may indeed be the more appropriate one.

— You are receiving this because you modified the open/close state.

Reply to this email directly, view it on GitHub < https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450488969 , or mute the thread < https://github.com/notifications/unsubscribe-auth/AAMV5r_aFfbTEWc5Bojf_g94UtXSK0lrks5u911ugaJpZM4ZhOkt

.

--

Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

— You are receiving this because you commented. Reply to this email directly, view it on GitHub, or mute the thread.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450645410, or mute the thread https://github.com/notifications/unsubscribe-auth/AAMV5viFwrOnCGhH7oL4omTjnxQi869Yks5u-g_-gaJpZM4ZhOkt .

maximilianh commented 5 years ago

oops. I see what you mean. I thought you were refering to how crispor shows the results. But you were refering mostly to the UCSC tracks. I agree that this is not optimal.

How do you think this should be handled in

1) crispor.org: just leave as it is? add some sort of warning? ignore the second copy of the PAR region? 2) UCSC tracks: always ignore the second copy of the PAR region?

On Tue, Jan 1, 2019 at 8:29 PM Evgeni Frenkel notifications@github.com wrote:

Hi Maximilian,

Thanks for sending the link to the crispr-details file!

Regarding pseudoautosomal genes, X and Y are of course different chromosomes but the pseudoautosomal regions behave as if they belong to the same chromosome, including recombination during meiosis, so it makes most sense to treat the X and Y copies as different alleles of the same gene. Trying to target the Y copy and not X copy of a PAR gene is like trying to target paternal and not maternal allele of an autosomal gene. There are only ~25 PAR genes, and I agree that any user targeting them should be aware that they can violate otherwise-sensible assumptions of a specificity score, but automated work (such as I'm doing) using the UCSC tracks can run in to trouble with these genes because their guides get labeled with the note, "This guide sequence is not unique in the genome. The specificity scores were not determined."

Best, Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Mon, Dec 31, 2018 at 8:24 AM Maximilian Haeussler < notifications@github.com> wrote:

Hi Evgeni,

the off-target information is contained in a second file, crisprDetails.tab. The format is documented in the crispr track docs page: http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&c=chr1&g=crispr

"pseudoautosomal status": Currently, if there is an exact match on a chromosome, I ignore matches on *_alt chromosomes. This addresses regions with _alt names because they do not appear in the same cell. But that's not your question.

I'm not sure how PARs should be handled, it seems like my current treatment is OK. You think the other match should be ignored? But someone who modifies these regions certainly knows that they are in a PAR region, wouldn't they? Isn't it correct to treat these regions as off-targets, because the other location really is an off-target, as it's on a different chromosome? If I don't show these off-targets, wouldn't people erroneously think they're in the clear, even though they have to be careful with these guides and check the other chromosome for editing?

On Sun, Dec 30, 2018 at 4:09 PM Evgeni Frenkel <notifications@github.com

wrote:

Yes I'm trying both tools for the purpose of genome-wide library design. FlashFry is faster but (as far as I can tell) only outputs statistics on guide specificity and does not list the specific potential off-target sites for each guide, which CRISPOR does and is something we'd like to include for the library. I downloaded CRISPOR guide track of UCSC and didn’t see these off target sites annotated.

Something I noticed that may be of interest is that the guide specificity calculation currently doesn’t take into account the pseudoautosomal status of certain genes on the X and Y chromosomes. All guides for these genes are treated as non-specific because the exact sequence is detected on another chromosome, but in these special cases these identical sequences correspond to the same gene.

On Sat, Dec 29, 2018 at 7:17 AM Maximilian Haeussler < notifications@github.com> wrote:

I see that you're using FlashFry now. If you're designing libraries, then crispor is probably not the best tool and flashfry may indeed be the more appropriate one.

— You are receiving this because you modified the open/close state.

Reply to this email directly, view it on GitHub <

https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450488969

,

or mute the thread <

https://github.com/notifications/unsubscribe-auth/AAMV5r_aFfbTEWc5Bojf_g94UtXSK0lrks5u911ugaJpZM4ZhOkt

.

--

Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

— You are receiving this because you commented. Reply to this email directly, view it on GitHub, or mute the thread.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub < https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450645410 , or mute the thread < https://github.com/notifications/unsubscribe-auth/AAMV5viFwrOnCGhH7oL4omTjnxQi869Yks5u-g_-gaJpZM4ZhOkt

.

— You are receiving this because you commented. Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450751719, or mute the thread https://github.com/notifications/unsubscribe-auth/AAS-TUo7YufRISL-5HF8T7ikJmHRTSh9ks5u-7ccgaJpZM4ZhOkt .

genya commented 5 years ago

as a matter of opinion, I think optimal is:

1) ignore second copy but add flag that it's a PAR region 2) ignore second copy

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Wed, Jan 2, 2019 at 8:37 AM Maximilian Haeussler < notifications@github.com> wrote:

oops. I see what you mean. I thought you were refering to how crispor shows the results. But you were refering mostly to the UCSC tracks. I agree that this is not optimal.

How do you think this should be handled in

1) crispor.org: just leave as it is? add some sort of warning? ignore the second copy of the PAR region? 2) UCSC tracks: always ignore the second copy of the PAR region?

On Tue, Jan 1, 2019 at 8:29 PM Evgeni Frenkel notifications@github.com wrote:

Hi Maximilian,

Thanks for sending the link to the crispr-details file!

Regarding pseudoautosomal genes, X and Y are of course different chromosomes but the pseudoautosomal regions behave as if they belong to the same chromosome, including recombination during meiosis, so it makes most sense to treat the X and Y copies as different alleles of the same gene. Trying to target the Y copy and not X copy of a PAR gene is like trying to target paternal and not maternal allele of an autosomal gene. There are only ~25 PAR genes, and I agree that any user targeting them should be aware that they can violate otherwise-sensible assumptions of a specificity score, but automated work (such as I'm doing) using the UCSC tracks can run in to trouble with these genes because their guides get labeled with the note, "This guide sequence is not unique in the genome. The specificity scores were not determined."

Best, Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Mon, Dec 31, 2018 at 8:24 AM Maximilian Haeussler < notifications@github.com> wrote:

Hi Evgeni,

the off-target information is contained in a second file, crisprDetails.tab. The format is documented in the crispr track docs page: http://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hg19&c=chr1&g=crispr

"pseudoautosomal status": Currently, if there is an exact match on a chromosome, I ignore matches on *_alt chromosomes. This addresses regions with _alt names because they do not appear in the same cell. But that's not your question.

I'm not sure how PARs should be handled, it seems like my current treatment is OK. You think the other match should be ignored? But someone who modifies these regions certainly knows that they are in a PAR region, wouldn't they? Isn't it correct to treat these regions as off-targets, because the other location really is an off-target, as it's on a different chromosome? If I don't show these off-targets, wouldn't people erroneously think they're in the clear, even though they have to be careful with these guides and check the other chromosome for editing?

On Sun, Dec 30, 2018 at 4:09 PM Evgeni Frenkel < notifications@github.com

wrote:

Yes I'm trying both tools for the purpose of genome-wide library design. FlashFry is faster but (as far as I can tell) only outputs statistics on guide specificity and does not list the specific potential off-target sites for each guide, which CRISPOR does and is something we'd like to include for the library. I downloaded CRISPOR guide track of UCSC and didn’t see these off target sites annotated.

Something I noticed that may be of interest is that the guide specificity calculation currently doesn’t take into account the pseudoautosomal status of certain genes on the X and Y chromosomes. All guides for these genes are treated as non-specific because the exact sequence is detected on another chromosome, but in these special cases these identical sequences correspond to the same gene.

On Sat, Dec 29, 2018 at 7:17 AM Maximilian Haeussler < notifications@github.com> wrote:

I see that you're using FlashFry now. If you're designing libraries, then crispor is probably not the best tool and flashfry may indeed be the more appropriate one.

— You are receiving this because you modified the open/close state.

Reply to this email directly, view it on GitHub <

https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450488969

,

or mute the thread <

https://github.com/notifications/unsubscribe-auth/AAMV5r_aFfbTEWc5Bojf_g94UtXSK0lrks5u911ugaJpZM4ZhOkt

.

--

Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

— You are receiving this because you commented. Reply to this email directly, view it on GitHub, or mute the thread.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub <

https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450645410

, or mute the thread <

https://github.com/notifications/unsubscribe-auth/AAMV5viFwrOnCGhH7oL4omTjnxQi869Yks5u-g_-gaJpZM4ZhOkt

.

— You are receiving this because you commented. Reply to this email directly, view it on GitHub < https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450751719 , or mute the thread < https://github.com/notifications/unsubscribe-auth/AAS-TUo7YufRISL-5HF8T7ikJmHRTSh9ks5u-7ccgaJpZM4ZhOkt

.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-450864902, or mute the thread https://github.com/notifications/unsubscribe-auth/AAMV5ucw5PX_DORttpfTgThM6gYcWQOoks5u_LX6gaJpZM4ZhOkt .

maximilianh commented 5 years ago

OK I made a change: 1) if input target sequence is in PAR: keep only match on chrY 2) off-targets: skip all PAR1 matches on chrX

Output warning when input sequence is in the PAR region.

Annotate off-targets with "PAR" note if they fall into the PAR.

Example: http://crispor-beta.tefor.net/crispor.py?batchId=CMUfzCWvDgaslOgGGS4c

maximilianh commented 5 years ago

As for the UCSC track, this is a lot harder to update. I'll defer this for now.

genya commented 5 years ago

Hi Maximillian, that sounds good, although the X chromosome copy of the par regions is the one that’s present in all cells male and female so might make more sense for that to be the default, rather the Y.

If you have a moment, I’ve a question about batch running jobs of CRISPOR on a cluster (with the LSF job management software). I find that single jobs complete fine but batches fail during execution. In each case crispor.py is fed a fasta file with multiple exons and it gets through some of them before encountering a fatal error and rarely it does manage to get through all of them. The errors vary but usually have something to do with wu-crispr.pl (some examples below). I wonder if disabling the Wu score calculation by commenting out the relevant lines would solve the problem, wasn't planning to use this score anyways. Is there a variable somewhere in the code that specifies the list of scores to be calculated? Now I'm running jobs to see if changing def calcWuCrisprScore(seqs) in crisporEffScores.py to return all zeros without calculations will solve the problem. If you have any advice, I'd greatly appreciate it. Thanks in any case for your help so far!

INFO:root:Progress QUFeJopy0IF1EuqpI9e2 - done - Job completed INFO:root: * running on sequence 'HGNC:7943 exon names ENST00000368680.3_17 range=chr1:153689433-153689541 strand=+', guideLen=20, seqLen=109 [M::bwa_idx_load_from_disk] read 0 ALT contigs [bsw2_aln] read 1 sequences/pairs (109 bp) ... [main] Version: 0.7.15-r1140 [main] CMD: /lab/solexa_sabatini/genya/crisporWebsite2/bin/Linux/bwa bwasw -T 20 /lab/solexa_sabatini/genya/crisporWebsite2/genomes/hg38/hg38.fa /tmp/crisporBestMatchuiKOkc.fa [main] Real time: 2.403 sec; CPU: 2.378 sec INFO:root:Progress 3djq5qsXOeF0F3C1mzeO - effScores - Calculating guide efficiency scores No such file or directory at wu-crispr.pl line 137. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1070, in calcWuCrisprScore assert(os.system(cmd)==0) AssertionError

Use of uninitialized value $oligoSearch in pattern match (m//) at wu-crispr.pl line 154, line 5. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1093, in calcWuCrisprScore start = int(pos.split(",")[0])-1 ValueError: invalid literal for int() with base 10: ''

On Fri, Jan 4, 2019 at 7:44 AM Maximilian Haeussler < notifications@github.com> wrote:

As for the UCSC track, this is a lot harder to update. I'll defer this for now.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub, or mute the thread.

genya commented 5 years ago

I just realized the Wu score is not included in the default output, which for me has the scores Doench '16-Score Doench '16-Old-Score Chari-Score Xu-Score Doench '14-Score Wang-Score Moreno-Mateos-Score Azimuth in-vitro-Score CCTop-Score Out-of-Frame-Score

Is the Wu score calculation used for something else? Is setting it to zero always going to break something else? Please let me know.

Thanks! Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Fri, Jan 4, 2019 at 12:00 PM Evgeni (Genya) Frenkel genya@wi.mit.edu wrote:

Hi Maximillian, that sounds good, although the X chromosome copy of the par regions is the one that’s present in all cells male and female so might make more sense for that to be the default, rather the Y.

If you have a moment, I’ve a question about batch running jobs of CRISPOR on a cluster (with the LSF job management software). I find that single jobs complete fine but batches fail during execution. In each case crispor.py is fed a fasta file with multiple exons and it gets through some of them before encountering a fatal error and rarely it does manage to get through all of them. The errors vary but usually have something to do with wu-crispr.pl (some examples below). I wonder if disabling the Wu score calculation by commenting out the relevant lines would solve the problem, wasn't planning to use this score anyways. Is there a variable somewhere in the code that specifies the list of scores to be calculated? Now I'm running jobs to see if changing def calcWuCrisprScore(seqs) in crisporEffScores.py to return all zeros without calculations will solve the problem. If you have any advice, I'd greatly appreciate it. Thanks in any case for your help so far!

INFO:root:Progress QUFeJopy0IF1EuqpI9e2 - done - Job completed INFO:root: * running on sequence 'HGNC:7943 exon names ENST00000368680.3_17 range=chr1:153689433-153689541 strand=+', guideLen=20, seqLen=109 [M::bwa_idx_load_from_disk] read 0 ALT contigs [bsw2_aln] read 1 sequences/pairs (109 bp) ... [main] Version: 0.7.15-r1140 [main] CMD: /lab/solexa_sabatini/genya/crisporWebsite2/bin/Linux/bwa bwasw -T 20 /lab/solexa_sabatini/genya/crisporWebsite2/genomes/hg38/hg38.fa /tmp/crisporBestMatchuiKOkc.fa [main] Real time: 2.403 sec; CPU: 2.378 sec INFO:root:Progress 3djq5qsXOeF0F3C1mzeO - effScores - Calculating guide efficiency scores No such file or directory at wu-crispr.pl line 137. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1070, in calcWuCrisprScore assert(os.system(cmd)==0) AssertionError

Use of uninitialized value $oligoSearch in pattern match (m//) at wu-crispr.pl line 154, line 5. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1093, in calcWuCrisprScore start = int(pos.split(",")[0])-1 ValueError: invalid literal for int() with base 10: ''

On Fri, Jan 4, 2019 at 7:44 AM Maximilian Haeussler < notifications@github.com> wrote:

As for the UCSC track, this is a lot harder to update. I'll defer this for now.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub, or mute the thread.

genya commented 5 years ago

Hi Maximilian, was able to answer my own question: commenting out the Wu-score calculation in crisporEffScores.py indeed eliminated the errors when running many crispor.py jobs in parallel out of the same directory, and the resulting outputs look good, same as the website.

Best, Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Fri, Jan 4, 2019 at 12:06 PM Evgeni (Genya) Frenkel genya@wi.mit.edu wrote:

I just realized the Wu score is not included in the default output, which for me has the scores Doench '16-Score Doench '16-Old-Score Chari-Score Xu-Score Doench '14-Score Wang-Score Moreno-Mateos-Score Azimuth in-vitro-Score CCTop-Score Out-of-Frame-Score

Is the Wu score calculation used for something else? Is setting it to zero always going to break something else? Please let me know.

Thanks! Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Fri, Jan 4, 2019 at 12:00 PM Evgeni (Genya) Frenkel genya@wi.mit.edu wrote:

Hi Maximillian, that sounds good, although the X chromosome copy of the par regions is the one that’s present in all cells male and female so might make more sense for that to be the default, rather the Y.

If you have a moment, I’ve a question about batch running jobs of CRISPOR on a cluster (with the LSF job management software). I find that single jobs complete fine but batches fail during execution. In each case crispor.py is fed a fasta file with multiple exons and it gets through some of them before encountering a fatal error and rarely it does manage to get through all of them. The errors vary but usually have something to do with wu-crispr.pl (some examples below). I wonder if disabling the Wu score calculation by commenting out the relevant lines would solve the problem, wasn't planning to use this score anyways. Is there a variable somewhere in the code that specifies the list of scores to be calculated? Now I'm running jobs to see if changing def calcWuCrisprScore(seqs) in crisporEffScores.py to return all zeros without calculations will solve the problem. If you have any advice, I'd greatly appreciate it. Thanks in any case for your help so far!

INFO:root:Progress QUFeJopy0IF1EuqpI9e2 - done - Job completed INFO:root: * running on sequence 'HGNC:7943 exon names ENST00000368680.3_17 range=chr1:153689433-153689541 strand=+', guideLen=20, seqLen=109 [M::bwa_idx_load_from_disk] read 0 ALT contigs [bsw2_aln] read 1 sequences/pairs (109 bp) ... [main] Version: 0.7.15-r1140 [main] CMD: /lab/solexa_sabatini/genya/crisporWebsite2/bin/Linux/bwa bwasw -T 20 /lab/solexa_sabatini/genya/crisporWebsite2/genomes/hg38/hg38.fa /tmp/crisporBestMatchuiKOkc.fa [main] Real time: 2.403 sec; CPU: 2.378 sec INFO:root:Progress 3djq5qsXOeF0F3C1mzeO - effScores - Calculating guide efficiency scores No such file or directory at wu-crispr.pl line 137. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1070, in calcWuCrisprScore assert(os.system(cmd)==0) AssertionError

Use of uninitialized value $oligoSearch in pattern match (m//) at wu-crispr.pl line 154, line 5. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1093, in calcWuCrisprScore start = int(pos.split(",")[0])-1 ValueError: invalid literal for int() with base 10: ''

On Fri, Jan 4, 2019 at 7:44 AM Maximilian Haeussler < notifications@github.com> wrote:

As for the UCSC track, this is a lot harder to update. I'll defer this for now.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub, or mute the thread.

maximilianh commented 5 years ago

Great ! I have the impression I should add an option to disable scores from the command line... or at least only calculate those that are used...

On Sat, Jan 5, 2019 at 7:33 AM Evgeni Frenkel notifications@github.com wrote:

Hi Maximilian, was able to answer my own question: commenting out the Wu-score calculation in crisporEffScores.py indeed eliminated the errors when running many crispor.py jobs in parallel out of the same directory, and the resulting outputs look good, same as the website.

Best, Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Fri, Jan 4, 2019 at 12:06 PM Evgeni (Genya) Frenkel genya@wi.mit.edu wrote:

I just realized the Wu score is not included in the default output, which for me has the scores Doench '16-Score Doench '16-Old-Score Chari-Score Xu-Score Doench '14-Score Wang-Score Moreno-Mateos-Score Azimuth in-vitro-Score CCTop-Score Out-of-Frame-Score

Is the Wu score calculation used for something else? Is setting it to zero always going to break something else? Please let me know.

Thanks! Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Fri, Jan 4, 2019 at 12:00 PM Evgeni (Genya) Frenkel <genya@wi.mit.edu

wrote:

Hi Maximillian, that sounds good, although the X chromosome copy of the par regions is the one that’s present in all cells male and female so might make more sense for that to be the default, rather the Y.

If you have a moment, I’ve a question about batch running jobs of CRISPOR on a cluster (with the LSF job management software). I find that single jobs complete fine but batches fail during execution. In each case crispor.py is fed a fasta file with multiple exons and it gets through some of them before encountering a fatal error and rarely it does manage to get through all of them. The errors vary but usually have something to do with wu-crispr.pl (some examples below). I wonder if disabling the Wu score calculation by commenting out the relevant lines would solve the problem, wasn't planning to use this score anyways. Is there a variable somewhere in the code that specifies the list of scores to be calculated? Now I'm running jobs to see if changing def calcWuCrisprScore(seqs) in crisporEffScores.py to return all zeros without calculations will solve the problem. If you have any advice, I'd greatly appreciate it. Thanks in any case for your help so far!

INFO:root:Progress QUFeJopy0IF1EuqpI9e2 - done - Job completed INFO:root: * running on sequence 'HGNC:7943 exon names ENST00000368680.3_17 range=chr1:153689433-153689541 strand=+', guideLen=20, seqLen=109 [M::bwa_idx_load_from_disk] read 0 ALT contigs [bsw2_aln] read 1 sequences/pairs (109 bp) ... [main] Version: 0.7.15-r1140 [main] CMD: /lab/solexa_sabatini/genya/crisporWebsite2/bin/Linux/bwa bwasw -T 20 /lab/solexa_sabatini/genya/crisporWebsite2/genomes/hg38/hg38.fa /tmp/crisporBestMatchuiKOkc.fa [main] Real time: 2.403 sec; CPU: 2.378 sec INFO:root:Progress 3djq5qsXOeF0F3C1mzeO - effScores - Calculating guide efficiency scores No such file or directory at wu-crispr.pl line 137. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1070, in calcWuCrisprScore assert(os.system(cmd)==0) AssertionError

Use of uninitialized value $oligoSearch in pattern match (m//) at wu-crispr.pl line 154, line 5. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1093, in calcWuCrisprScore start = int(pos.split(",")[0])-1 ValueError: invalid literal for int() with base 10: ''

On Fri, Jan 4, 2019 at 7:44 AM Maximilian Haeussler < notifications@github.com> wrote:

As for the UCSC track, this is a lot harder to update. I'll defer this for now.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub, or mute the thread.

— You are receiving this because you commented.

Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-451632268, or mute the thread https://github.com/notifications/unsubscribe-auth/AAS-TYhJGdMDXpsCQRFvGagVNcszzz-Nks5vAEcrgaJpZM4ZhOkt .

genya commented 5 years ago

I think only matters if the unused calculations require noticeable amount of computation time or, as in this case, cause an error.

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Sat, Jan 5, 2019 at 2:46 AM Maximilian Haeussler < notifications@github.com> wrote:

Great ! I have the impression I should add an option to disable scores from the command line... or at least only calculate those that are used...

On Sat, Jan 5, 2019 at 7:33 AM Evgeni Frenkel notifications@github.com wrote:

Hi Maximilian, was able to answer my own question: commenting out the Wu-score calculation in crisporEffScores.py indeed eliminated the errors when running many crispor.py jobs in parallel out of the same directory, and the resulting outputs look good, same as the website.

Best, Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Fri, Jan 4, 2019 at 12:06 PM Evgeni (Genya) Frenkel <genya@wi.mit.edu

wrote:

I just realized the Wu score is not included in the default output, which for me has the scores Doench '16-Score Doench '16-Old-Score Chari-Score Xu-Score Doench '14-Score Wang-Score Moreno-Mateos-Score Azimuth in-vitro-Score CCTop-Score Out-of-Frame-Score

Is the Wu score calculation used for something else? Is setting it to zero always going to break something else? Please let me know.

Thanks! Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Fri, Jan 4, 2019 at 12:00 PM Evgeni (Genya) Frenkel < genya@wi.mit.edu

wrote:

Hi Maximillian, that sounds good, although the X chromosome copy of the par regions is the one that’s present in all cells male and female so might make more sense for that to be the default, rather the Y.

If you have a moment, I’ve a question about batch running jobs of CRISPOR on a cluster (with the LSF job management software). I find that single jobs complete fine but batches fail during execution. In each case crispor.py is fed a fasta file with multiple exons and it gets through some of them before encountering a fatal error and rarely it does manage to get through all of them. The errors vary but usually have something to do with wu-crispr.pl (some examples below). I wonder if disabling the Wu score calculation by commenting out the relevant lines would solve the problem, wasn't planning to use this score anyways. Is there a variable somewhere in the code that specifies the list of scores to be calculated? Now I'm running jobs to see if changing def calcWuCrisprScore(seqs) in crisporEffScores.py to return all zeros without calculations will solve the problem. If you have any advice, I'd greatly appreciate it. Thanks in any case for your help so far!

INFO:root:Progress QUFeJopy0IF1EuqpI9e2 - done - Job completed INFO:root: * running on sequence 'HGNC:7943 exon names ENST00000368680.3_17 range=chr1:153689433-153689541 strand=+', guideLen=20, seqLen=109 [M::bwa_idx_load_from_disk] read 0 ALT contigs [bsw2_aln] read 1 sequences/pairs (109 bp) ... [main] Version: 0.7.15-r1140 [main] CMD: /lab/solexa_sabatini/genya/crisporWebsite2/bin/Linux/bwa bwasw -T 20 /lab/solexa_sabatini/genya/crisporWebsite2/genomes/hg38/hg38.fa /tmp/crisporBestMatchuiKOkc.fa [main] Real time: 2.403 sec; CPU: 2.378 sec INFO:root:Progress 3djq5qsXOeF0F3C1mzeO - effScores - Calculating guide efficiency scores No such file or directory at wu-crispr.pl line 137. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1070, in calcWuCrisprScore assert(os.system(cmd)==0) AssertionError

Use of uninitialized value $oligoSearch in pattern match (m//) at wu-crispr.pl line 154, line 5. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1093, in calcWuCrisprScore start = int(pos.split(",")[0])-1 ValueError: invalid literal for int() with base 10: ''

On Fri, Jan 4, 2019 at 7:44 AM Maximilian Haeussler < notifications@github.com> wrote:

As for the UCSC track, this is a lot harder to update. I'll defer this for now.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub, or mute the thread.

— You are receiving this because you commented.

Reply to this email directly, view it on GitHub < https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-451632268 , or mute the thread < https://github.com/notifications/unsubscribe-auth/AAS-TYhJGdMDXpsCQRFvGagVNcszzz-Nks5vAEcrgaJpZM4ZhOkt

.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-451635628, or mute the thread https://github.com/notifications/unsubscribe-auth/AAMV5vX6zzcZXn4hYP1JOJASoodW4wYUks5vAFg4gaJpZM4ZhOkt .

maximilianh commented 5 years ago

Hi Evgeni, I've added the options "--effScores" now to the command line interface. Also, it should not calculate anymore any efficiency scores that are not in the allScores global variable. This required a few changes to crisporEffScores.py

On Sat, Jan 5, 2019 at 9:54 PM Evgeni Frenkel notifications@github.com wrote:

I think only matters if the unused calculations require noticeable amount of computation time or, as in this case, cause an error.

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Sat, Jan 5, 2019 at 2:46 AM Maximilian Haeussler < notifications@github.com> wrote:

Great ! I have the impression I should add an option to disable scores from the command line... or at least only calculate those that are used...

On Sat, Jan 5, 2019 at 7:33 AM Evgeni Frenkel notifications@github.com wrote:

Hi Maximilian, was able to answer my own question: commenting out the Wu-score calculation in crisporEffScores.py indeed eliminated the errors when running many crispor.py jobs in parallel out of the same directory, and the resulting outputs look good, same as the website.

Best, Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Fri, Jan 4, 2019 at 12:06 PM Evgeni (Genya) Frenkel < genya@wi.mit.edu

wrote:

I just realized the Wu score is not included in the default output, which for me has the scores Doench '16-Score Doench '16-Old-Score Chari-Score Xu-Score Doench '14-Score Wang-Score Moreno-Mateos-Score Azimuth in-vitro-Score CCTop-Score Out-of-Frame-Score

Is the Wu score calculation used for something else? Is setting it to zero always going to break something else? Please let me know.

Thanks! Genya

-- Evgeni (Genya) Frenkel, PhD Whitehead Institute for Biomedical Research Lab of David M Sabatini http://sabatinilab.wi.mit.edu/membersDS.html

On Fri, Jan 4, 2019 at 12:00 PM Evgeni (Genya) Frenkel < genya@wi.mit.edu

wrote:

Hi Maximillian, that sounds good, although the X chromosome copy of the par regions is the one that’s present in all cells male and female so might make more sense for that to be the default, rather the Y.

If you have a moment, I’ve a question about batch running jobs of CRISPOR on a cluster (with the LSF job management software). I find that single jobs complete fine but batches fail during execution. In each case crispor.py is fed a fasta file with multiple exons and it gets through some of them before encountering a fatal error and rarely it does manage to get through all of them. The errors vary but usually have something to do with wu-crispr.pl (some examples below). I wonder if disabling the Wu score calculation by commenting out the relevant lines would solve the problem, wasn't planning to use this score anyways. Is there a variable somewhere in the code that specifies the list of scores to be calculated? Now I'm running jobs to see if changing def calcWuCrisprScore(seqs) in crisporEffScores.py to return all zeros without calculations will solve the problem. If you have any advice, I'd greatly appreciate it. Thanks in any case for your help so far!

INFO:root:Progress QUFeJopy0IF1EuqpI9e2 - done - Job completed INFO:root: * running on sequence 'HGNC:7943 exon names ENST00000368680.3_17 range=chr1:153689433-153689541 strand=+', guideLen=20, seqLen=109 [M::bwa_idx_load_from_disk] read 0 ALT contigs [bsw2_aln] read 1 sequences/pairs (109 bp) ... [main] Version: 0.7.15-r1140 [main] CMD: /lab/solexa_sabatini/genya/crisporWebsite2/bin/Linux/bwa bwasw -T 20 /lab/solexa_sabatini/genya/crisporWebsite2/genomes/hg38/hg38.fa /tmp/crisporBestMatchuiKOkc.fa [main] Real time: 2.403 sec; CPU: 2.378 sec INFO:root:Progress 3djq5qsXOeF0F3C1mzeO - effScores - Calculating guide efficiency scores No such file or directory at wu-crispr.pl line 137. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1070, in calcWuCrisprScore assert(os.system(cmd)==0) AssertionError

Use of uninitialized value $oligoSearch in pattern match (m//) at wu-crispr.pl line 154, line 5. Traceback (most recent call last): File "crispor.py", line 7996, in main() File "crispor.py", line 7994, in main mainCommandLine() File "crispor.py", line 7808, in mainCommandLine getOfftargets(seq, org, pamPat, batchId, startDict, ConsQueue()) File "crispor.py", line 4132, in getOfftargets processSubmission(faFname, org, pamDesc, otBedFname, batchBase, batchId, queue) File "crispor.py", line 3731, in processSubmission createBatchEffScoreTable(batchId) File "crispor.py", line 3366, in createBatchEffScoreTable guideRows = calcGuideEffScores(seq, extSeq, pam) File "crispor.py", line 3317, in calcGuideEffScores effScores = crisporEffScores.calcAllScores(longSeqs, enzyme=enz) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 818, in calcAllScores scores["wuCrispr"] = calcWuCrisprScore(trimSeqs(seqs, -20, 4)) File "/lab/solexa_sabatini/genya/crisporWebsite2/crisporEffScores.py", line 1093, in calcWuCrisprScore start = int(pos.split(",")[0])-1 ValueError: invalid literal for int() with base 10: ''

On Fri, Jan 4, 2019 at 7:44 AM Maximilian Haeussler < notifications@github.com> wrote:

As for the UCSC track, this is a lot harder to update. I'll defer this for now.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub, or mute the thread.

— You are receiving this because you commented.

Reply to this email directly, view it on GitHub <

https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-451632268

, or mute the thread <

https://github.com/notifications/unsubscribe-auth/AAS-TYhJGdMDXpsCQRFvGagVNcszzz-Nks5vAEcrgaJpZM4ZhOkt

.

— You are receiving this because you modified the open/close state. Reply to this email directly, view it on GitHub < https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-451635628 , or mute the thread < https://github.com/notifications/unsubscribe-auth/AAMV5vX6zzcZXn4hYP1JOJASoodW4wYUks5vAFg4gaJpZM4ZhOkt

.

— You are receiving this because you commented. Reply to this email directly, view it on GitHub https://github.com/maximilianh/crisporWebsite/issues/22#issuecomment-451689545, or mute the thread https://github.com/notifications/unsubscribe-auth/AAS-TeF4-ecSQQFrJzHcP9T5RHG36x0Tks5vARDtgaJpZM4ZhOkt .