search

mcveanlab / mccortex

De novo genome assembly and multisample variant calling
https://github.com/mcveanlab/mccortex/wiki
MIT License
113 stars 25 forks source link

server occasionally returns invalid JSON #28

Closed Phelimb closed 8 years ago

Phelimb commented 8 years ago

E.g.

TGCCGGCGCGGGTGGCCGCCG { "key": "CGGCGGCCACCCGCGCCGGCA", "colours": [1], ", "right": "C", "edges": "02", "links": [] }

Looks like it's missing the "left" entry partially.

noporpoise commented 8 years ago

Hi Phelim,

Thanks for spotting this - it's a bad bug. Uninitialised memory was being accessed. I've pushed a fix on develop and master branches.

To update: git pull; git submodule update --recursive --init

Phelimb commented 8 years ago

:+1:

Thanks Issac. The server is a great feature.