server occasionally returns edges that aren't valid ints

mcveanlab / mccortex

De novo genome assembly and multisample variant calling

https://github.com/mcveanlab/mccortex/wiki

MIT License

113 stars 25 forks source link

Closed Phelimb closed 8 years ago

Phelimb commented 8 years ago

e.g.

ATGCGTTATATTCGCCTGTGT { "key": "ACACAGGCGAATATAACGCAT", "colours": [1], "left": "AT", "right": "A", "edges": "a3", "links": [] }

I'm not sure if this is intended behaviour though?

noporpoise commented 8 years ago

Edge coding is explained here in the wiki:

It's a compact way to specify each samples' edges using only two characters per colour.