mhalushka / miRge

miRge - microRNA alignment software for small RNA-seq data, now at v2.0

GNU General Public License v3.0

27 stars 14 forks source link

writeDataToCSV error #18

Closed snowlover closed 5 years ago

snowlover commented 5 years ago

Summarizing and tabulating results... Traceback (most recent call last): site-packages/mirge/utils/writeDataToCSV.py", line 541, in detectMismach if target_seq[i] != seqTmp[i]: IndexError: string index out of range

mhalushka commented 5 years ago

Hi. Thanks. I haven't seen that issue before. Can you give me some additional information on what you were trying to do and what your setup is?

snowlover commented 5 years ago

Hi. I really don't know more information about this issue. I used all default paramters to 'annotate' ordinary mirna-seq fastq files ... I didn't expect this error when generating the summary tables ...

mhalushka commented 5 years ago

I'm not sure why that has happened. I haven't seen that problem before. Can you try running it with a different sample and see if that problem recurs? I wouldn't have expected that error either.

snowlover commented 5 years ago

Hi. I only have about 7 samples from the same dataset, it seems they had the same error. fastq reads are like this:

@HWI-:308:HGL2:1:1101:1458:2076 1:N:0:GCCAAT NGTCTGAGCGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG +

<<GGIIIGGIIIGGGIIIGGIIGIIIIGGGIIIIIGGIIIIIIIIGGIG

mhalushka commented 5 years ago

Do all of your samples have a N in the first position? If so, you might want to use cutadapt to remove them. I don't think we tested miRge2.0 with an N in the first position and that might be cause a problem.

snowlover commented 5 years ago

ok, i thought cutadapt in miRge2 may remove them. thanks.