Mirge Libraries

[kokyriakidis]

Hi! I would like to know to which version of the human genome these libraries correspond to?

[mhalushka]

Human Dec. 2013 (GRCh38/hg38) Assembly.

[vivekruhela]

To run this pipeline, I manually collected all the necessary libraries (i.e. mature.fa, hairpin.fa from mirbase, hg38.fa etc.) with folder name human and then run miRge annotate then I get an error of missing human_merge_miRBase.csv. Then I tried to download libraries for human species using the from the link given in the command in read me (https://jh.box.com/shared/static/rj7ufy5v15uw7ytsyyrsryw99u7ml82j.gz) then I found that the shared file is missing. So I have two concerns:

1. miRge.Libs directory structure is missing (i.e. specific names of all the libraries which are used within miRge2 script) and I don't know what is content of human_merge_miRBase.csv file?
2. The shared libraries llink missing

[mhalushka]

Sorry about that. They shut down our Box and moved my materials to OneDrive. The link for the human materials is here: https://livejohnshopkins-my.sharepoint.com/:u:/g/personal/mhalush1_jh_edu/EUkL2ZbRpKRXJpemY32dObgBCyiiPbIiuzKCglrtBUIsFA?e=VCoc5h. Let me know if you are unable to access this. It is important that you have the merges file in the proper folder location and it is called correctly (that was a problem for a different user).

[vivekruhela]

Thanks. I have successfully downloaded the libraries. But After running the command

miRge2.0 annotate -s raw_data.fastq.gz -pb /mnt/disk2/Mirpipe/Packages1/bowtie-1.2.3-linux-x86_64 -lib /mnt/disk2/Mirpipe/mirge2/miRge/miRge.Libs/ -sp human ad illumina -ai -gff -trf -cpu 4.

I got the following errror:

/mnt/disk2/Mirpipe/mirge2/miRge/miRge.Libs/human/annotation.Libs/human_trna.str does not exsit. Please check it.

I also found the same that the corrosponding file is missing in annotation.Libs folder.

[vivekruhela]

The above problem is solved by adding files from missingtrffiles.zip. I would like to know for predict module, Is it mendatory to have samtools and rnafold binaryI files even when I have already added samtools and rnafold in my default paths /usr/bin/samtools (and same for rnafold). ?

EDIT-1: The reason of asking above question is that samtools and RNAfold is already installed in my system and their path are as follows: which samtools /usr/bin/local which RNAfold /use/local/bin/RNAfold

But when I add the same path in miRge predict command (as shown below) then I am getting an error:

(python_mirge) vivek@sbilab-MS-7B49:/mnt/disk2/round_1/mirge2$ miRge2.0 predict -s raw_data.fastq -pb /mnt/disk2/Packages1/bowtie-1.2.3-linux-x86_64 -lib /mnt/disk2/miRge/miRge.Libs/ -sp human -ps /usr/bin/samtools -pr /usr/local/bin/RNAfold -ad TGGAATTCTCGGGTGCCAAGG -ai -gff -trf -cpu 4

samtools can't be found in /usr/bin/samtools. Please check it.

RNAfold can't be found in /usr/local/bin/RNAfold. Please check it.

[vivekruhela]

Above issue is solved. Thanks.

[mhalushka]

Ok. Just to verify, it looks like all of your issues are resolved now. Is that correct? Thank you for working through them.

[vivekruhela]

Yes. I am getting correct results. Thanks.

[hesamhakim]

The human and mouse libraries are not accessible via the new link. Other libraries are still accessible.

[arunhpatil]

@hesamhakim, the libraries for miRge2.0 can be accessed here: human and mouse. Let me know if you are able to download it.

Also, we now have the latest version of this package miRge3.0 and the link for the preprint can be found here.