search

miRTop / incubator

Where all ideas and discussions happen to lead to new repositories
5 stars 4 forks source link

incubator/format/definition.md: Multiple variants #23

Open phillipeloher opened 6 years ago

phillipeloher commented 6 years ago

Are multiple variants allowed for the same reported isomiR sequence?

For example, isomiR Sequence TGGGGCGGAGCTTCCGGAGGC has the following possible locations just within miRBase22. MIMAT0015058_2&hsa-miR-3180-3p&offsets|0|-1 MIMAT0018178_1&hsa-miR-3180&offsets|0|+2 MIMAT0015058_1&hsa-miR-3180-3p&offsets|0|-1 MIMAT0015058&hsa-miR-3180-3p&offsets|0|-1

If so, what would the recommendation of the above be? Should folks generating the GFF3 file be encouraged to report all four (including the 0|-1 and 0|+2 offsets) above within Column 9->Attributes->variant?

lpantano commented 6 years ago

Moving to: https://github.com/miRTop/mirGFF3/issues/2