Open abartlett004 opened 2 years ago
For hsa-let-7f-1-3p with reference sequence CTATACAATCTATTGCCTTCCC, an isomiR with sequence CTATACAATCTATTGCCTTCCT is described in the _rawData.tsv file as having only a T addition and no trimming on the 3' end.
_rawData.tsv
miRTop used from container as part of nf-core smrnaseq pipeline
data from this project
For hsa-let-7f-1-3p with reference sequence CTATACAATCTATTGCCTTCCC, an isomiR with sequence CTATACAATCTATTGCCTTCCT is described in the
_rawData.tsvfile as having only a T addition and no trimming on the 3' end.miRTop used from container as part of nf-core smrnaseq pipeline
data from this project