Open jonahcullen opened 1 year ago
Apologies I should have looked a little closer and reported the isoLabel
that is causing the issue - -$16:G>A,19:T>C,20:G>A
with the full line (excluding RPMs):
TGGAATGTAAGGAAGTATGCAG eca-miR-1$eca-miR-206 eca-mir-1-2$eca-mir-1-1$eca-mir-206-2 nta#G|nta#G#1$NucVar -$16:G>A,19:T>C,20:G>A
Thank you for submitting this error. Could you share the hairpin file, and the GFF file. I can try to debug with those and the line you identified as problematic.
Do you know what the -
symbol would mean there?
Thank you for your response! I do not know what -
means here, it occurs rarely along side other variants (e.g.18:A>G
) but always causes an error when it is the first one listed. That same column (sequenceVariant
) contains -
with no other variants as well. I'm guessing the update from sRNAbench v1.2 or v1.6 to 2.0 is what is causing the issue. For example, exact
no longer occurs any in the microRNAannotation.txt
file.
I've attached the eca3.ens_mirtop.gff.txt, hairpin.fa.txt (miRBase v22 filtered to include only eca), and the microRNAannotation.txt files. Apologies I had to append the fasta and GFF with .txt
.
Expected behavior and actual behavior.
I am attempting to use
mirtop gff
from the output of sRNAbench. I expect a GFF to be returned. I am able to get this to work with the output frommiraligner
.Steps to reproduce the problem.
returns
Specifications like the version of the project, operating system, or hardware.
I am using
mirtop
(0.4.25) andsRNAbench.jar
(2.0) on a university HPC running CentOS Linux 7.Thanks for your time, Jonah.