Closed swuecho closed 8 years ago
Could you post nucleotide sequences of corresponding clonotypes, along with alignment field and D alignment scores. Basically you can just copy corresponding lines from default export output of either alignments or assembled clonotypes.
above result is generated by
/home/hwu/app/mixcr-1.7.2/mixcr align --loci IGH seq.fastq seq.vdjca
/home/hwu/app/mixcr-1.7.2/mixcr assemble seq.vdjca seq.clns
/home/hwu/app/mixcr-1.7.2/mixcr exportAlignments seq.vdjca alignments.txt
/home/hwu/app/mixcr-1.7.2/mixcr exportClones seq.clns clones.txt
perl -n -E 'print if /CAGGSGLPYW/' clones.txt >clones_debug.txt
perl -n -E 'print if /CAGGSGLPYW/' alignments.txt > alignment_debug.txt
did not try mixcr 1.6, since I saw new version 1.7.2
I don't see any problems with these two clones:
There are two clones with different nucleotide sequences, and with two different D genes that most likely be used during their rearrangement:
Clone1:
TGTGCGGGAGGCAGTGGTCTCCCCTACTGG
gggtataGCAGTGGctggtac - IGHD6-19
Clone2:
TGTGCGGGAGGTAGTGGTCTCCCCTACTGG
gtattactatgataGTAGTGGTtattactac - IGHD3-22
So alignments are ok, and D genes were assigned as good as possible. However, as there are many similar D genes for IGH, it is practically impossible to tell for sure which D gene was used in each particular rearrangement. Situation is moreover complicated by hypermutations (which seems to be the case here).
If D genes are of particular interest in your research, you should adopt some approach like one described by Aleksandra Walczak and collegues in the following papers: http://www.pnas.org/content/109/40/16161.short http://rstb.royalsocietypublishing.org/content/370/1676/20140243.abstract
Thanks!
I got this result from one of my analysis.
cmd option
mixcr exportClones -vHit -jHit -dHit -count -aaFeature CDR3
in mixcr version 1.6in mixcr version 1.7.2
seems D assignment is not that accurate?
Thanks.