Feature request: custom headers in a snap file

[quantori-pokidovea]

That would be nice to have an extra context inside the snap file. For example

---
source: src/secondary_structure/bulge.rs
expression: bulge
---
sense: TCCCCTAGCTTTTAGCTATGGGGA
anti_sense: AGGGGTATCGATTTTCGATCCCCT
forward_init_x: 6
---
Bulge {
    description: "/bulge(-T)",
    entropy: Entropy(
        -35.510002,
    ),
    enthalpy: Enthalpy(
        -7.8,
    ),
    interim_oligo: Some(
        Sequence(T),
    ),
    wc_stack: Some(
        WCStack(CT/GA),
    ),
}

So, we can see some circumstances which led to the snapshot's body.

[max-sixty]

Possibly description or debug_expr could be serialized using the same serializer — and then we could add fields without an additional field?

(it would be a small breaking change though, unless we did something like attempt both the serialized and unserialized versions)

[pokidovea]

It could be the same section as for the regular headers. It doesn't matter. The main idea is to be able to populate headers with custom ones.

[mitsuhiko]

Would you expect the review tool to show these headers?

[tyao1]

Would love this feature as well. I would like to ignore the headers section, because we use buck internally and cargo externally, and they have different root directories for source and output files, I couldn't get snapshot to stay the same between two build systems.