Do not refine deletion SV because new sequence is too long

[weilu1998]

Hi,

When I tried to run deletion refinement using the Iris module, I got a lot of error message about new sequence too long. I am curious what does it mean for a deletion SV type?

Here is the output

Starting to process Hmel206001o_RagTag:10652508:DEL:Sniffles2.DEL.1B37S17 (time = 00:00:00:03.841)
Found 4 relevant reads for Hmel206001o_RagTag:10652508:DEL:Sniffles2.DEL.1B37S17 (time = 00:00:00:04.370)
Found 1 consensus sequences for Hmel206001o_RagTag:10652508:DEL:Sniffles2.DEL.1B37S17 (time = 00:00:00:04.681)
Found 1 alignment records for Hmel206001o_RagTag:10652508:DEL:Sniffles2.DEL.1B37S17 (time = 00:00:00:04.782)
Did not change Hmel206001o_RagTag:10652508:DEL:Sniffles2.DEL.1B37S17 because new sequence too long (time = 00:00:00:04.782)
No refined SV found for Hmel206001o_RagTag:10652508:DEL:Sniffles2.DEL.1B37S17 (time = 00:00:00:04.782)

The sniffles2 VCF for this variant

Hmel206001o_RagTag 10652508 Sniffles2.DEL.1B37S17 CTTTGGATTACACTACCGAAGGAATAAAAAATCATTGGCGGTAGCTTGTAAAGTATTCGGAATTTAAGTAATTTAACATAGCTTATATATCCTTCTTTAGTAAGTGAAATATCCAATACAAAATGATAGTTAAATTTTAGC N55 PASS PRECISE;SVTYPE=DEL;SVLEN=-141;END=10652649;SUPPORT=4;RNAMES=7e3adec4-a550-44d1-858c-cea3a8e71b3a,6fdae76b-e76f-4ee8-b67f-e3949cad24e9,dffe64be-ee71-4101-89e0-78e802e6356e,f43cdde6-58cc-4263-bb8c-1910f229452d;COVERAGE=4,4,4,4,5;STRAND=-;AF=1.000;STDEV_LEN=0.000;STDEV_POS=0.000 GT:GQ:DR:DV 1/1:11:0:4

IGV plot for this deletion (Top: VCF file, Middle: Bam, Bottom: repeat annotation)

[noorsmal]

I have the same issue with no deletions being refined by Iris even with the option --also_deletions. Did you find a way around this?

[noorsmal]

I found that running it seperate for deletions with max_len_change=-0.25 instead of 0.25 works for me.