search

mrmckain / Fast-Plast

Automated de novo assembly of whole chloroplast genomes.
MIT License
44 stars 13 forks source link

No trimmed read files were identified to run SPAdes #40

Open ef391 opened 4 years ago

ef391 commented 4 years ago

Hello, I have the same problem with the one in issue #13

"Samples for All are not in current GenBank plastomes. Using one representative from each order to make bowtie2 indices. **ERROR: No trimmed read files were identified to run SPAdes. Please check 1_Trimmed_Reads.**"

I tried to follow the recommendations in issue #13, it seems the bowtie2 folder does not contain the indices.. I tried to re-install but the problem persists.

Could you please advise?

Many thanks E

mrmckain commented 4 years ago

Hi,

When you installed, did you give Fast-Plast the full path to your bowtie2 installation? Or did you have Fast-Plast install it for you?

Best, Michael

ef391 commented 4 years ago

Hi Michael

Happy New Year and thanks for your quick response!

I had the Fast-Plast install it for me... I checked the fast-plast.pl and it seems the path is correct I think: my $BOWTIE2="/Users/EF/Fast-Plast/bin/bowtie2-2.2.9/bowtie2"; #path to bowtie2 executable

E

mrmckain commented 4 years ago

Could you post some of the error outputs for me? Thanks!

ef391 commented 4 years ago

Thu Jan 2 09:49:41 2020 Starting Fast-Plast v.1.2.8. Assemblying plastome with 0 single end libraries and 1 paired end libraries. Thu Jan 2 09:49:41 2020 Determining best kmer sizes. K-mer sizes for SPAdes set at 55,69,87. Thu Jan 2 09:49:41 2020 Starting read trimming with Trimmomatic. Using /Users/EF/Fast-Plast/bin/Trimmomatic-0.36//trimmomatic-0.36.jar. Thu Jan 2 09:50:43 2020 Starting read mapping with bowtie2. Using /Users/EF/Fast-Plast/bin/bowtie2-2.2.9/bowtie2. Samples for All are not in current GenBank plastomes. Using one representative from each order to make bowtie2 indices. Thu Jan 2 09:50:45 2020 Starting initial assembly with SPAdes. Using /Users/EF/Fast-Plast/bin/SPAdes-3.11.1-Linux/bin/spades.py. **ERROR: No mapped reads files were identified to run SPAdes. Please check 2_Bowtie_Mapping.**

ef391 commented 4 years ago

TrimmomaticPE: Started with arguments: -threads 4 /Users/EF/Bartramia_2747_GCCAAT_L007_R1_001.fastq /Users/EF/Bartramia_2747_GCCAAT_L007_R2_001.fastq Bartramia2_0.trimmed_P1.fq Bartramia2_0.trimmed_U1.fq Bartramia2_0.trimmed_P2.fq Bartramia2_0.trimmed_U2.fq ILLUMINACLIP:/Users/EF/Fast-Plast/bin/adapters/NEB-PE.fa:1:30:10 SLIDINGWINDOW:10:20 MINLEN:40 Using Long Clipping Sequence: 'ACACTCTTTCCCTACACGACGCTCTTCCGATC' Using Long Clipping Sequence: 'GATCGGAAGAGCACACGTCTGAACTCCAGTC' ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Quality encoding detected as phred33 Input Read Pairs: 6097933 Both Surviving: 3210074 (52.64%) Forward Only Surviving: 974423 (15.98%) Reverse Only Surviving: 469372 (7.70%) Dropped: 1444064 (23.68%) TrimmomaticPE: Completed successfully Traceback (most recent call last): File "/Users/EF/Fast-Plast/bin/bowtie2-2.2.9/bowtie2-build", line 95, in main() File "/Users/EF/Fast-Plast/bin/bowtie2-2.2.9/bowtie2-build", line 92, in main os.execv(build_bin_spec, argv) OSError: [Errno 8] Exec format error sh: /Users/EF/Fast-Plast/bin/bowtie2-2.2.9/bowtie2-align-s: cannot execute binary file (ERR): Description of arguments failed! Exiting now ... No mapped reads files were identified to run SPAdes. Please check 2_Bowtie_Mapping.

mrmckain commented 4 years ago

I have tried to replicate the error but cannot. Can you look in the 2_Bowtie_Mapping directory and tell me if there is a file called All.fsa and .bt2 files? Are there map files in that directory as well?