Issues with path to blast executable?

[ethan-baldwin]

I've pasted the error output below. It appears that when the program is trying to use blast for the plastome finishing step, it is missing a "/" in the path to the blast executable. It looks like it is trying to call: /apps/eb/BLAST+/2.10.1-gompi-2019b/binblastn But the correct path is: /apps/eb/BLAST+/2.10.1-gompi-2019b/bin/blastn

Is this an issue with installation?

TrimmomaticPE: Started with arguments:
 -threads 4 /scratch/eab77806/trimmed_reads/m017_R1_P.fastq.gz /scratch/eab77806/trimmed_reads/m017_R2_P.fastq.gz m017_0.trimmed_P1.fq m017_0.trimmed_U1.fq m017_0.trimmed_P2.fq m017_0.trimmed_U2.fq ILLUMINACLIP:/apps/eb/Fast-Plast/1.2.8-foss-2019b-Perl-5.30.0/bin/adapters/NEB-PE.fa:1:30:10 SLIDINGWINDOW:10:20 MINLEN:40
Using Long Clipping Sequence: 'ACACTCTTTCCCTACACGACGCTCTTCCGATC'
Using Long Clipping Sequence: 'GATCGGAAGAGCACACGTCTGAACTCCAGTC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Read Pairs: 4178953 Both Surviving: 4098605 (98.08%) Forward Only Surviving: 63267 (1.51%) Reverse Only Surviving: 15619 (0.37%) Dropped: 1462 (0.03%)
TrimmomaticPE: Completed successfully
Use of uninitialized value $bt2_args[5] in join or string at /apps/eb/Bowtie2/2.4.1-GCC-8.3.0/bin/bowtie2 line 423.
Use of uninitialized value $bt2_args[6] in join or string at /apps/eb/Bowtie2/2.4.1-GCC-8.3.0/bin/bowtie2 line 423.
Use of uninitialized value in exists at /apps/eb/Bowtie2/2.4.1-GCC-8.3.0/bin/bowtie2 line 81.
Use of uninitialized value in exists at /apps/eb/Bowtie2/2.4.1-GCC-8.3.0/bin/bowtie2 line 81.
Use of uninitialized value $bt2_args[5] in join or string at /apps/eb/Bowtie2/2.4.1-GCC-8.3.0/bin/bowtie2 line 459.
Use of uninitialized value $bt2_args[6] in join or string at /apps/eb/Bowtie2/2.4.1-GCC-8.3.0/bin/bowtie2 line 459.
4177491 reads; of these:
  4098605 (98.11%) were paired; of these:
    4030841 (98.35%) aligned concordantly 0 times
    35542 (0.87%) aligned concordantly exactly 1 time
    32222 (0.79%) aligned concordantly >1 times
    ----
    4030841 pairs aligned concordantly 0 times; of these:
      7037 (0.17%) aligned discordantly 1 time
    ----
    4023804 pairs aligned 0 times concordantly or discordantly; of these:
      8047608 mates make up the pairs; of these:
        8029608 (99.78%) aligned 0 times
        2838 (0.04%) aligned exactly 1 time
        15162 (0.19%) aligned >1 times
  78886 (1.89%) were unpaired; of these:
    77424 (98.15%) aligned 0 times
    773 (0.98%) aligned exactly 1 time
    689 (0.87%) aligned >1 times
2.04% overall alignment rate
sh: /apps/eb/BLAST+/2.10.1-gompi-2019b/binblastn: No such file or directory
sh: /apps/eb/BLAST+/2.10.1-gompi-2019b/binblastn: No such file or directory
sh: /apps/eb/BLAST+/2.10.1-gompi-2019b/binblastn: No such file or directory
sh: /apps/eb/BLAST+/2.10.1-gompi-2019b/binblastn: No such file or directory
sh: /apps/eb/BLAST+/2.10.1-gompi-2019b/binblastn: No such file or directory
sh: /apps/eb/BLAST+/2.10.1-gompi-2019b/binblastn: No such file or directory
Died at /apps/eb/Fast-Plast/1.2.8-foss-2019b-Perl-5.30.0/fast-plast.pl line 876.

[mrmckain]

Yes, that is an installation error. Did you give Fast-Plast the path to something pre-installed or have FP install blast for you?

[ethan-baldwin]

I believe the former. I had university staff install this on our HPCC (the GACRC at UGA, which you might be familiar with!), so I will have to reach out to them about this. Is blast involved in identifying the IRs by chance?

Also, I am having issues using the built-in bowtie indices. If I try to use Ericales for example, FP will create an empty file called Ericales.fsa in the Bowtie_Mapping directory, and no bowtie index files or mapped reads files, and obviously the spades assembly can't run. I can grab the error log for those runs and start another issue for that if that would help.

[mrmckain]

Blast is used to ID genes to SC or IR. SC and IR and identified using a perl script that looks for reverse complement regions of a sliding window.

Can you post the command you used to call Fast-Plast? Also your other error files? You should be getting an Ericales.fsa file.

[ethan-baldwin]

Sure, the command is:

fast-plast.pl -1 /scratch/eab77806/trimmed_reads/m017_R1_P.fastq.gz -2 /scratch/eab77806/trimmed_reads/m017_R2_P.fastq.gz --name m017 --bowtie_index Ericales --coverage_analysis

I attached the error file. Again, there is an Ericales.fsa in the mapping directory, but it is empty.

m017_results_error.log