Trimmomatic problem

[Jorge-82]

Hi -after installing the last updated version of Fast-Plast (everything went OK, no single error during installation) I'm getting an error related to Trimmomatic. Any clue what could be wrong? thanks

Mon Nov 14 12:55:55 2022 Starting Fast-Plast v.1.2.9. Assemblying plastome with 0 single end libraries and 1 paired end libraries. Mon Nov 14 12:55:55 2022 Determining best kmer sizes. K-mer sizes for SPAdes set at 31,37,43. Mon Nov 14 12:55:55 2022 Starting read trimming with Trimmomatic. Using /home/jorge/Fast-Plast/bin/Trimmomatic-0.39//trimmomatic-0.39.jar. Mon Nov 14 12:55:59 2022 Starting read mapping with bowtie2. Using /home/jorge/Fast-Plast/bin/bowtie2-2.3.5.1-linux-x86_64/bowtie2. Samples for Poales used to make bowtie2 indices. **ERROR: No trimmed read files were identified to run SPAdes. Please check 1_Trimmed_Reads.**

[mrmckain]

Hi Jorge,

Please post the error and out files that are made with Fast-Plast. Those will have move information to help diagnose the issue.

Best, Michael

[Jorge-82]

Hi Michael, thanks! TrimmomaticPE: Started with arguments: -threads 4 /home/jorge/Fast-Plast/787.1.fq /home/jorge/Fast-Plast/787.2.fq TEST787_0.trimmed_P1.fq TEST787_0.trimmed_U1.fq TEST787_0.trimmed_P2.fq TEST787_0.trimmed_U2.fq ILLUMINACLIP:/home/jorge/Fast-Plast/bin/adapters/NEB-PE.fa:1:30:10 SLIDINGWINDOW:10:20 MINLEN:140 Using Long Clipping Sequence: 'ACACTCTTTCCCTACACGACGCTCTTCCGATC' Using Long Clipping Sequence: 'GATCGGAAGAGCACACGTCTGAACTCCAGTC' ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Quality encoding detected as phred33 Input Read Pairs: 5711538 Both Surviving: 0 (0.00%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 5711538 (100.00%) TrimmomaticPE: Completed successfully /usr/bin/env: ‘python’: No such file or directory No trimmed read files were identified to run SPAdes. Please check 1_Trimmed_Reads.

[kgturner]

Hi, installed this today and I have this error as well. Any thoughts? Progress, out, and error logs below (out was empty).

To me, it looks like there is an extra / when calling trimmomatic-0.39.jar? But maybe that is just in the log file.

Thanks for your help!

turnkat2.isu@ondemand ~/software/Fast-Plast > cat Taraxacum_officinale_ERR10116842_Fast-Plast_Progress.log Mon Sep 11 14:56:53 2023 Starting Fast-Plast v.1.2.9. Assemblying plastome with 0 single end libraries and 1 paired end libraries. Mon Sep 11 14:56:53 2023 Determining best kmer sizes. K-mer sizes for SPAdes set at 55,87,121. Mon Sep 11 14:56:53 2023 Starting read trimming with Trimmomatic. Using /lfs/turnkat2.isu/software/Fast-Plast/bin/Trimmomatic-0.39//trimmomatic-0.39.jar. Mon Sep 11 14:56:53 2023 Starting read mapping with bowtie2. Using /lfs/turnkat2.isu/software/Fast-Plast/bin/bowtie2-2.3.5.1-linux-x86_64/bowtie2. Samples for Asterales used to make bowtie2 indices. **ERROR: No trimmed read files were identified to run SPAdes. Please check 1_Trimmed_Reads.** turnkat2.isu@ondemand ~/software/Fast-Plast > cat Taraxacum_officinale_ERR10116842_results_out.log turnkat2.isu@ondemand ~/software/Fast-Plast > cat Taraxacum_officinale_ERR10116842_results_error.log Can't exec "java": No such file or directory at fast-plast.pl line 427. cat: 'Taraxacum_officinale_ERR10116842trimmed_P1.fq': No such file or directory cat: 'Taraxacum_officinale_ERR10116842trimmed_P2.fq': No such file or directory /usr/bin/env: ‘python’: No such file or directory No trimmed read files were identified to run SPAdes. Please check 1_Trimmed_Reads.

[kgturner]

It occurred to me that I should have loaded python3.6 first. I now have a similar but not identical error. This time out.log wasn't empty. Taraxacum_officinale_ERR10116842_results_out.log

Taraxacum_officinale_ERR10116842_results_error.log

Taraxacum_officinale_ERR10116842_Fast-Plast_Progress.log

Thanks for your help.

[mrmckain]

Hi Kathryn,

Did you load java? There is an error saying it is not a "file".

Best, Michael