search

nanoporetech / pychopper

A tool to identify, orient, trim and rescue full length cDNA reads
Other
80 stars 22 forks source link

question about the primer sequence #31

Closed huangziyan11111 closed 4 years ago

huangziyan11111 commented 4 years ago

Hi, I found the default primer sequence (cDNA_SSP_VNP.fas) you use is like this:

VNP ACTTGCCTGTCGCTCTATCTTCTTTTTTTTT SSP TTTCTGTTGGTGCTGATATTGCTGGG

However, the Oxford Nanopore universal tag is: 5’-TTTCTGTTGGTGCTGATATTGC-3’ for forward primers 5’-ACTTGCCTGTCGCTCTATCTTC-3’ for reverse primers

See that your primer sequences contain the Oxford Nanopore universal tag. Is it right to have more sequence or just use the Oxford Nanopore universal tag?

bsipos commented 4 years ago

The primers are actually are not used in the default profile HMM mode. The "universal tags" are used for PCR, but these primers are based on the reverse transcription and strand switching primers. I advise do not to change them unless you are using custom oligos.