search

ndaniel / fusioncatcher

Finder of Somatic Fusion Genes in RNA-seq data
GNU General Public License v3.0
142 stars 67 forks source link

Floating point exception (core dumped) during step 146 #166

Closed evcon131 closed 3 years ago

evcon131 commented 4 years ago

I have run a few files from the same experiment with no issue but with one set I keep getting this error after a few minutes:

Time loading forward index: 00:00:03
Floating point exception (core dumped)
ndaniel commented 4 years ago

Hello evcon131,

it is a little bit challenging to say what is going on because FusionCatcher is running several tools and aligners and looking above it looks like one of those has crashed but it is not clear which one.

Would be possible to have the logs of the run (e.g. fusioncatcher.log and info.txt)?

evcon131 commented 4 years ago

sure here's the log:

Log of the pipeline:
--------------------------------------------------------------------------------
Starting execution with step 146.
////////////////////////////////////////////////////////////////////////////////
  Running: step = 1   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
================================================
Software version: fusioncatcher.py 1.20
================================================

"  \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 2   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
Software version: fusioncatcher.py 1.20
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/fusioncatcher.log
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 3   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 4   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 5   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Skipping from erasing '/lab_data/avery_lab/reference_files/fc_cf_2020_1_5/version.txt' (size: 383 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 6   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 7   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Skipping from erasing '/lab_data/avery_lab/reference_files/fc_cf_2020_1_5/genome_information.txt' (size: 101 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 8   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
Linux:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 9   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
cat \
/etc/issue  \
2>&1  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 10   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
Python:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 11   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
python_version.py \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 12   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
BioPython:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 13   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
biopython_version.py \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 14   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
===========
TOOLS:
===========
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 15   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
SORT:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 16   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
sort \
--version  \
|  \
head -1 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 17   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
BOWTIE:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 18   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
bowtie \
--version  \
|  \
head -2 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 19   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
BBMAP:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 20   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
bbmap.sh \
--version  \
2>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 21   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
PIGZ:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 22   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
pigz \
--version  \
2>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 23   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
PXZ:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 24   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
fastq-dump (from SRA Toolkit):
--------------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 25   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
fastq-dump \
2>&1  \
|  \
tail -2 \
|  \
head -1 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 26   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
GNU Parallel:
--------------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 27   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
SAMTools:
---------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 28   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
samtools \
2>&1  \
|  \
head -3 \
|  \
tail -1 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 29   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
Java:
---------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 30   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
java \
--version  \
2>&1  \
|  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 31   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
liftOver:
---------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 32   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
liftOver \
2>&1  \
|  \
head -1 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 33   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
SeqTK:
---------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 34   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
seqtk \
2>&1  \
|  \
head -3 \
|  \
tail -1 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 35   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
sed:
---------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 36   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
sed \
--version  \
2>&1  \
|  \
head -1 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 37   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
awk:
---------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 38   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
awk \
-Wversion  \
2>&1  \
|  \
head -1 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt \
||  \
awk  \
--version  \
2>&1  \
|  \
head -1 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 39   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
BLAT:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 40   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
blat \
|  \
head -1 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 41   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
faToTwoBit (from BLAT toolbox):
----------------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 42   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
faToTwoBit \
2>&1  \
> /dev/null \
|  \
head -1 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 43   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
STAR:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 44   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
STAR \
--version  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 45   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

BOWTIE2:
------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 46   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
bowtie2 \
--version  \
2>&1  \
|  \
head -2 \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 47   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 48   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 49   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 50   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Skipping from erasing '/lab_data/avery_lab/apps/fusioncatcher/etc/configuration.cfg' (size: 1035 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 51   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
============
DATA DIRECTORY:
============
/lab_data/avery_lab/reference_files/fc_cf_2020_1_5/
It is not a link!

"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 52   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 53   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
============
MEMORY:
============
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 54   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
free \
-m  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 55   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
Total installed RAM memory = 515885 MB"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 56   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
Input files (which contain the short reads):
/lab_data/avery_lab/tmp_files/tzn_evan/raw_reads/TZL38094_1.fq.gz
/lab_data/avery_lab/tmp_files/tzn_evan/raw_reads/TZL38094_2.fq.gz
////////////////////////////////////////////////////////////////////////////////
  Running: step = 57   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 58   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
pigz \
-p 5 \
-d  \
-f  \
-c  \
 /lab_data/avery_lab/tmp_files/tzn_evan/raw_reads/TZL38094_1.fq.gz \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 59   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
pigz \
-p 5 \
-d  \
-f  \
-c  \
 /lab_data/avery_lab/tmp_files/tzn_evan/raw_reads/TZL38094_2.fq.gz \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 60   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

First 8 lines of input FASTQ file: /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq
-------------------------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 61   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
head \
-8 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 62   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

First 8 lines of input FASTQ file: /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq
-------------------------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 63   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
head \
-8 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 64   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

Last 8 lines of input FASTQ file: /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq
-------------------------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 65   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
tail \
-8 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 66   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

Last 8 lines of input FASTQ file: /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq
-------------------------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 67   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
tail \
-8 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 68   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
overlap.py \
--input_1 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq \
--input_2 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq \
--processes 5 \
--fail-gracefully  \
--output /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_overlaps__0.txt \
2> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_overlaps_error__0.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 69   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
|==> SKIPPED workflow's IF because of the step count (value returned in the previous run is used).
Result of IF = FALSE [Unique Id = #DIFFERENT_SIZES_OF_READS_OVERLAP_0#]
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 70   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 71   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_overlaps__0.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 72   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_overlaps_error__0.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 73   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
remove-adapter.py \
--processes 5 \
--input_1 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq \
--input_2 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq \
--output_1 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-noadapt-0_TZL38094_1.fq \
--output_2 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-noadapt-1_TZL38094_2.fq \
--trim-n 3 \
--link hard \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_adapters_0.txt \
2>&1 
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 74   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 75   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_adapters_0.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 76   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
remove-bad-illumina.py \
--input /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-noadapt-0_TZL38094_1.fq \
--output /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-clear-noadapt-0_TZL38094_1.fq \
--link hard \
2> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_bad_illumina_1_0.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 77   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 78   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_bad_illumina_1_0.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 79   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
remove-bad-illumina.py \
--input /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-noadapt-1_TZL38094_2.fq \
--output /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-clear-noadapt-1_TZL38094_2.fq \
--link hard \
2> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_bad_illumina_2_0.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 80   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 81   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_bad_illumina_2_0.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 82   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
sra2illumina.py \
--input_1 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-clear-noadapt-0_TZL38094_1.fq \
--input_2 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-clear-noadapt-1_TZL38094_2.fq \
--output_1 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-sra-clear-noadapt-0_TZL38094_1.fq \
--output_2 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-sra-clear-noadapt-1_TZL38094_2.fq \
--link hard \
--tmp_dir /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/tmp/
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 83   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
seqtk \
mergepe  \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-sra-clear-noadapt-0_TZL38094_1.fq \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-sra-clear-noadapt-1_TZL38094_2.fq \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-shuffle-sra-clear-noadapt-0_TZL38094.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 84   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 85   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
Total Count of reads (from all FASTQ files given as input and before any read removal is done, i.e. quality filtering, pre-processing):
--------------
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 86   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-shuffle-sra-clear-noadapt-0_TZL38094.fq = "  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 87   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
LC_ALL=C \
cat  \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-shuffle-sra-clear-noadapt-0_TZL38094.fq \
|  \
echo $((`wc -l`/4))  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 88   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
solexa18to15.py \
--fail  \
--input /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-shuffle-sra-clear-noadapt-0_TZL38094.fq \
--output /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-head-shuffle-sra-clear-noadapt-0_TZL38094.fq \
--link hard
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 89   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
phred.py \
--link hard \
--input /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-head-shuffle-sra-clear-noadapt-0_TZL38094.fq \
--output /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-phred-head-shuffle-sra-clear-noadapt-0_TZL38094.fq \
--input_type auto-detect \
--output_type sanger \
--tmp_dir /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/tmp/
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 90   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 91   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Skipping the moving from:
'/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-phred-head-shuffle-sra-clear-noadapt-0_TZL38094.fq'
to:
'/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/orig__.fq'
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 92   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
bbduk.sh \
forcetrimmod=5 \
in=/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/orig__.fq \
out=/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/orig__x.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 93   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
bbduk.sh \
entropy=0.1 \
entropymask=t \
entropyk=2 \
entropywindow=40 \
in=/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/orig__x.fq \
out=/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/orig.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 94   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
LC_ALL=C \
cat  \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/orig.fq \
|  \
LC_ALL=C  \
paste - - - - - - - - \
|  \
pair8removal.py  \
-l 30 \
-i - \
-o - \
|  \
LC_ALL=C  \
sort  \
-k 2,2 \
-k 6,6 \
-u  \
-t '    ' \
--buffer-size 26G \
--parallel 5 \
-T /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/tmp/ \
|  \
LC_ALL=C  \
tr  \
"\t"  \
"\n"  \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/origi.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 95   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
unshuffle.py \
-i /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/origi.fq \
-f /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/ox1.fq \
-r /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/ox2.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 96   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
bowtie \
--seed 123456 \
-t  \
--seedmms 1 \
--seedlen 60 \
-X 10000 \
-p 5 \
-k 1 \
--phred33-quals  \
--chunkmbs 128 \
--un /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/ox.fq \
--max /dev/null \
 /lab_data/avery_lab/reference_files/fc_cf_2020_1_5/transcripts_index/ \
-1 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/ox1.fq \
-2 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/ox2.fq \
 /dev/null \
2> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_fast-filtering.stdout.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 97   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 98   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_fast-filtering.stdout.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 99   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
seqtk \
mergepe  \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/ox_1.fq \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/ox_2.fq \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/origin.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 100   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
lengths_reads.py \
--input /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/origin.fq \
--output /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_lengths_original_reads.txt \
--counts /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_counts_original_reads.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 101   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 102   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Skipping from erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_lengths_original_reads.txt' (size: 86 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 103   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
compress-reads-ids.py \
--input /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/origin.fq \
--output /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/original.fq \
--count-reads /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_counts_original_reads.txt \
--lowercase 
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 104   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 105   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_counts_original_reads.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 106   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

Input reads are broken up bioinformatically in smaller pieces due detection of very long reads!
----------------------

"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 107   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
bbmerge.sh \
in=/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/original.fq \
out=/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/merged.fq \
outu=/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/unmerged.fq \
threads=5 \
strict=f \
minoverlap=13 \
-Xmx18g
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 108   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
unshuffle.py \
-i /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/unmerged.fq \
-f /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/or1.fq \
-r /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/or2.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 109   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
fragment_fastq.py \
-1 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/or1.fq \
-2 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/or2.fq \
-f /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/originala-t1.fq \
--window-size 82 \
--step-size 49 \
--threshold-read 92 \
--anchors 1 \
--skip-short 60 \
--trim-n 
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 110   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
fragment_fastq.py \
-1 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/merged.fq \
-2 - \
-f /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/originala-t2.fq \
--window-size 82 \
--step-size 49 \
--threshold-read 92 \
--anchors 1 \
--skip-short 60 \
--trim-n 
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 111   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
cat \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/originala-t1.fq \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/originala-t2.fq \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/originala.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 112   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
lengths_reads.py \
--input /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/originala.fq \
--output /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_lengths_original_reads_final.txt \
--counts /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_counts_original_reads_final.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 113   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 114   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_counts_original_reads_final.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 115   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 116   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Skipping from erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_lengths_original_reads_final.txt' (size: 99 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 117   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Skipping the soft linking from:
'/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/originala.fq'
to:
'/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/original-t5-t3.fq'
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 118   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
trim_reads.py \
--input /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/original-t5-t3.fq \
--output /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads.fq \
--trim_end 3 \
--trim_n  \
--final_size 60
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 119   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
lengths_reads.py \
--input /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads.fq \
--output /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_lengths_reads.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 120   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 121   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 122   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Skipping from erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_lengths_reads.txt' (size: 3 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 123   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
seqtk \
seq  \
-L [ARGUMENT from file '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_minimum_length_short_read.txt'] \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads.fq \
|  \
seqtk  \
dropse  \
-  \
|  \
fastq_b2n.py  \
--input - \
--replacement A \
--sanger  \
--ambiguous  \
--threshold [ARGUMENT from file '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_minimum_length_short_read.txt'] \
--output - \
|  \
trim_poly_tails.py  \
--input - \
--repeats 16 \
--output - \
2>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt \
|  \
seqtk  \
seq  \
-L [ARGUMENT from file '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_minimum_length_short_read.txt'] \
-  \
|  \
seqtk  \
dropse  \
-  \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_acgt.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 124   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
pigz \
-p 5 \
--fast  \
-c /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/originala.fq \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/originala.fq.gz
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 125   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
LC_ALL=C \
cat  \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_acgt.fq \
|  \
echo $((`wc -l`/4))  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_removed_single_reads1.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 126   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 127   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Skipping from erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_removed_single_reads1.txt' (size: 10 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 128   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
|==> SKIPPED workflow's IF because of the step count (value returned in the previous run is used).
Result of IF = FALSE [Unique Id = #READS_ACGT.FQ#]
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 129   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 130   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"
============
MEMORY (before using BOWTIE):
============
"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 131   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
free \
-m  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 132   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
printf \
"

"  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 133   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
bowtie \
--seed 123456 \
-t  \
--seedmms 1 \
--seedlen 60 \
-p 5 \
-k 1 \
--phred33-quals  \
--chunkmbs 128 \
--un /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered_temp.fq \
--max /dev/null \
 /lab_data/avery_lab/reference_files/fc_cf_2020_1_5/rtrna_hla_mt_index/ \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_acgt.fq \
 /dev/null \
2> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_bowtie_reads-filtered-out.stdout.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 134   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 135   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_bowtie_reads-filtered-out.stdout.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 136   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
LC_ALL=C \
cat  \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered_temp.fq \
|  \
LC_ALL=C  \
paste - - - - \
|  \
LC_ALL=C  \
sort  \
-k 1,1 \
-t '    ' \
--buffer-size 26G \
--parallel 5 \
-T /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/tmp/ \
|  \
LC_ALL=C  \
tr  \
"\t"  \
"\n"  \
|  \
seqtk  \
dropse  \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered.fq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 137   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
LC_ALL=C \
cat  \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered.fq \
|  \
echo $((`wc -l`/4))  \
>> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_removed_single_reads2.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 138   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 139   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_removed_single_reads2.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 140   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 141   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_reads1_removed.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 142   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
LC_ALL=C \
cat  \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered.fq \
|  \
echo $((`wc -l`/4))  \
> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/count_reads_left_after_filtering.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 143   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 144   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
Skipping from erasing '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/count_reads_left_after_filtering.txt' (size: 10 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 145   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
|==> SKIPPED workflow's IF because of the step count (value returned in the previous run is used).
Result of IF = FALSE [Unique Id = #READS-FILTERED.FQ#]
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 146   Time: 10:46   Date: 2020-05-18 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/lab_data/avery_lab/tmp_files/tzn_evan/fc'
bowtie \
--seed 123456 \
-t  \
-k 200 \
-v 0 \
-p 5 \
-m 20 \
--suppress 5,6,7 \
--phred33-quals  \
--best  \
--strata  \
--chunkmbs 128 \
--un /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_filtered_not-mapped-genome.fq \
--max /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered_multiple-mappings-genome.fq \
 /lab_data/avery_lab/reference_files/fc_cf_2020_1_5/genome_index2/index \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered.fq \
 /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_filtered_genome.map \
2> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_bowtie_reads_mapped-genome.stdout.txt
--------------------------------------------------------------------------------
+-->EXECUTING...

ERROR: Workflow execution failed at step 146 while executing:
----------------
   bowtie \
   --seed 123456 \
   -t  \
   -k 200 \
   -v 0 \
   -p 5 \
   -m 20 \
   --suppress 5,6,7 \
   --phred33-quals  \
   --best  \
   --strata  \
   --chunkmbs 128 \
   --un /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_filtered_not-mapped-genome.fq \
   --max /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered_multiple-mappings-genome.fq \
    /lab_data/avery_lab/reference_files/fc_cf_2020_1_5/genome_index2/index \
    /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered.fq \
    /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_filtered_genome.map \
   2> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_bowtie_reads_mapped-genome.stdout.txt
----------------
  * Size '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_filtered_not-mapped-genome.fq' = 3478538115 bytes
  * Size '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered_multiple-mappings-genome.fq' = 43159635 bytes
  * Size '/lab_data/avery_lab/reference_files/fc_cf_2020_1_5/genome_index2/index' = 0 bytes
  * Size '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered.fq' = 17501057370 bytes
  * Size '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_filtered_genome.map' = 1565032448 bytes
Time loading forward index: 00:00:03
Floating point exception (core dumped)
################################################################################
################################################################################
TOTAL RUNNING TIME: 0 day(s), 0 hour(s), 4 minute(s), and 3 second(s) 
################################################################################
################################################################################

here's the info


================================================
Software version: fusioncatcher.py 1.20
================================================

===================================
GENOME INFORMATION:
===================================
fusioncatcher-build.py 1.20
Ensembl database version: 99
Organism: Canis familiaris
Genome version: CanFam3.1
NCBI Viral Genomes version: 2020-03-06
RefSeq NCBI database version (downloaded thru UCSC database; canFam3): 2020-03-01
Cancer Gene List database version: 2020-04-22
Oncogenes database version: 2020-04-22
CACG database version: 2020-04-22
DGD database version: 2020-04-22

===================================
Genome FASTA files:
===================================
ftp.ensembl.org//pub/release-99/fasta/canis_familiaris/dna/Canis_familiaris.CanFam3.1.dna.toplevel.fa

Linux:
------
Ubuntu 18.04.3 LTS \n \l

Python:
------
Python version: 2.7.17 (default, Apr 15 2020, 17:20:14) 
[GCC 7.5.0]
Python executable: /usr/bin/python

BioPython:
------
1.76

===========
TOOLS:
===========

SORT:
------
sort (GNU coreutils) 8.28

BOWTIE:
------
/lab_data/avery_lab/apps/fusioncatcher/tools/bowtie-1.2.3-linux-x86_64/bowtie-align-s version 1.2.3
64-bit

BBMAP:
------
java -ea -Xmx185133m -cp /lab_data/avery_lab/apps/fusioncatcher/tools/bbmap/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 --version
BBMap version 38.44
For help, please run the shellscript with no parameters, or look in /docs/.

PIGZ:
------
pigz 2.4

PXZ:
------

fastq-dump (from SRA Toolkit):
--------------
fastq-dump : 2.9.6

GNU Parallel:
--------------

SAMTools:
---------
Version: 1.10 (using htslib 1.10)

Java:
---------

liftOver:
---------
liftOver - Move annotations from one assembly to another

SeqTK:
---------
Version: 1.2-r101c-dirty

sed:
---------
sed (GNU sed) 4.4

awk:
---------
GNU Awk 4.1.4, API: 1.1 (GNU MPFR 4.0.1, GNU MP 6.1.2)

BLAT:
------
blat - Standalone BLAT v. 36x5 fast sequence search command line tool

faToTwoBit (from BLAT toolbox):
----------------
faToTwoBit - Convert DNA from fasta to 2bit format

STAR:
------
2.7.2b

BOWTIE2:
------
/lab_data/avery_lab/apps/fusioncatcher/tools/bowtie2/bowtie2-align-s version 2.3.5.1
64-bit

Pipeline parameters:
====================
aligners = /lab_data/avery_lab/apps/fusioncatcher/etc/configuration.cfg,blat,star
all_reads_junction = False
ambiguous_filtering = False
ambiguous_mismatches = 2
assembly = False
batch_mode = False
biotypes = 1000genomes,7skrna,ambiguous,banned,bodymap2,conjoing,cta,ctb,ctc,ctd,dist1000bp,ensembl_fully_overlapping,ensembl_same_strand_overlapping,fragments,healthy,hla,hpa,metazoa,mirna,mt,multi,pair_pseudo_genes,paralogs,refseq_fully_overlapping,refseq_same_strand_overlapping,removed,rp,rp11,rrna,similar_reads,similar_symbols,snorna,snrna,trna,yrna
bridges = 0
checksums_filename = checksums.txt
chunkmbs = 128
compress_transcripts = False
configuration_filename = /lab_data/avery_lab/apps/fusioncatcher/etc/configuration.cfg,/lab_data/avery_lab/apps/fusioncatcher/bin/configuration.cfg
data_directory = /lab_data/avery_lab/reference_files/fc_cf_2020_1_5/
extract_buffer_size = 1000000000
ff_tryhard = False
filter_mismatches = 2
filter_str = 0
force_paths = False
gap_wiggle_size = 2
hash = no
homolog = 1.25e-05
input_filename = ../raw_reads/TZL38094_1.fq.gz,../raw_reads/TZL38094_2.fq.gz
keep_preliminary = False
keep_temporary_files = False
keep_unmapped_reads = False
keep_viruses = False
length_anchor = 17,17,17,17,40
length_anchor2 = 47
length_anchor_gap = 17
length_anchor_gap_max = 100
length_gap = 21
limitOutSJcollapsed = 1000000
limitSjdbInsertNsj = 2000000
limit_blat = 3221225472
limit_bowtie = 4294867296
limit_bowtie2 = 30000000
limit_star = 500000000
long_report = False
min_dist = 200000
mismatches = 2
mismatches_gap = 7
mismatches_psl = 2
output_directory = TZL38094
paranoid_sensitive = False
processes = 5
psl_visualization = False
reads_preliminary_fusions = False
rescue_gap_size = 0
rescue_wiggle_size = 0
sam_visualization = False
single_end = False
skip_adapter_filtering = False
skip_adjacent = False
skip_automatic_scaling = False
skip_b_filtering = False
skip_banned_fusions = False
skip_bbmerge = False
skip_bbmerge_auto = False
skip_blat = False
skip_bowtie2 = True
skip_compress_ids = False
skip_conversion_grch37 = False
skip_deduplication = False
skip_extension = False
skip_fast = False
skip_filter_low_entropy = False
skip_genome_filtering = False
skip_genome_transcriptome_filtering = False
skip_ig_star = False
skip_interleave_processing = False
skip_known_fusions = False
skip_mitochondrion_filtering = False
skip_prefiltering_psl = False
skip_spotlight = False
skip_star = False
skip_star_bowtie = False
skip_trim_multiple_5 = False
skip_unmapped_pairs_filtering = False
skip_update_check = False
skip_viruses_filtering = False
sonication = 130
sort_buffer_size = 80%
spanning_pairs = 3,3,3,3,3
spanning_pairs_count = 8000
spanning_reads = 2,2,2,2,2
split_seqtk_subseq = 1
start_step = 0
tmp_directory = /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/tmp
trim_3end = 0
trim_3end_keep = 60
trim_3end_keep2 = 23
trim_5end = 0
trim_psl = False
trim_psl_3end_keep = 82
trim_psl_5end = False
trim_quality = 5
trim_wiggle = 0
trimfq = 1.0
xmx = 18g
main_script = /lab_data/avery_lab/apps/fusioncatcher/bin/fusioncatcher.py
main_script_version = 1.20

Current working directory:
---------------------------
/lab_data/avery_lab/tmp_files/tzn_evan/fc

Command line used for launching FusionCatcher:
----------------------------------------------
/lab_data/avery_lab/apps/fusioncatcher/bin/fusioncatcher.py \ 
-p \ 
5 \ 
-i \ 
../raw_reads/TZL38094_1.fq.gz,../raw_reads/TZL38094_2.fq.gz \ 
-o \ 
TZL38094 \ 
-d \ 
/lab_data/avery_lab/reference_files/fc_cf_2020_1_5/
----------------------------------------------

Shebang for Python scripts:
---------------------------
#!/usr/bin/env python

===================
CONFIGURATION.CFG:
===================
[paths]
python = /usr/bin/
#
# for changing the shebang for all Python scripts used by FusionCatcher 
# to '#!/some/other/python'
# one could run 'fusioncatcher/bin/shebang.py' -s #!/some/other/python
#
data = ../data/current/
scripts = ../bin/
bowtie = ../tools/bowtie/
bowtie2 = ../tools/bowtie2/
blat = ../tools/blat/
bwa = ../tools/bwa/
bbmap = ../tools/bbmap/
liftover = ../tools/liftover/
velvet = ../tools/velvet/
oases = ../tools/oases/
fatotwobit = ../tools/fatotwobit/
samtools = ../tools/samtools/
seqtk = ../tools/seqtk/
star = ../tools/star/source/
sra = ../tools/sratoolkit/bin/
numpy = ../tools/numpy/
biopython = ../tools/biopython/
xlrd = ../tools/xlrd/
openpyxl = ../tools/openpyxl/
lzo = ../tools/lzo/
lzop = ../tools/lzop/src/
coreutils = ../tools/coreutils/src/
parallel = ../tools/paralell/src/
pigz = ../tools/pigz/
pxz = ../tools/pxz/
picard = ../tools/picard/
java = /usr/bin/

[parameters]
threads = 0
aligners = blat,star

[versions]
fusioncatcher = 1.20

============
DATA DIRECTORY:
============
/lab_data/avery_lab/reference_files/fc_cf_2020_1_5/
It is not a link!

============
MEMORY:
============
              total        used        free      shared  buff/cache   available
Mem:         515885       38024      256138           7      221722      474880
Swap:          8191        1044        7147

Total installed RAM memory = 515885 MB

Input files (which contain the short reads):
--------------------------------------------
/lab_data/avery_lab/tmp_files/tzn_evan/raw_reads/TZL38094_1.fq.gz
/lab_data/avery_lab/tmp_files/tzn_evan/raw_reads/TZL38094_2.fq.gz

First 8 lines of input FASTQ file: /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq
-------------------------
@K00124:681:HNKF3BBXX:5:1101:10815:1485 2:N:0:NAACAGGC
NCCTAGGCCCCTGCGTCTGCCTCCCCATGGCCGGCAGAGGGCAGGCTGCATGCAGTGGCGGCTGGCGGGCCCTGTCCAGCCCCAGGACTCTGCGCGACATCAATGCTGGCTCTTTTCTCTTCTCGCCGTGTTGCCGTTGGTTTCACATGA
+
#-AAFFJJJFJJJJFJ<<-FJFJJFJAJJJJ<JJAJA<FFFJJJF-AFJJJF7-<7<<-FFJFA---AFJFFA<---77F7JJA7A7JJJJJJA<AA-F-AFJFFJA--FA<AJAJFJ<7<<---)-<-J<--777A-----AF--7---
@K00124:681:HNKF3BBXX:5:1101:32086:1485 2:N:0:NAACAGGC
NTGGCCTCCGACATGAAGTACAAGCCGGGCATCTTCTGGCGGCGGTGCAAGTCTGCCGGCGCCCAGCCCGCCGCCTCGGCAGCCCAAACCGTCATGTCATCGAAACCGAGATCTGAGGACGGCACTTAGCGGCGCCACCACTCCGATAGT
+
#-AAFA-------7<--7-F7-F-----7J--7<---<-A<J--7-7-----<--7-7-----------7-77----7--7--7---77--7F-77-F-F--777---7--777F--)-))-))))----7))-)))))))7))7)---7

First 8 lines of input FASTQ file: /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq
-------------------------
@K00124:681:HNKF3BBXX:5:1101:10815:1485 1:N:0:NAACAGGC
NTTAAACACAACTAAATCCTATCAGTACAGCAGGGTGGGAGCTATGAGGCAGGAGTGATGAATGGGTACTTCTGCATCCAGTGACCAAGGAATACACGTACGTATCACCTGGTGACCCACAGAAGTGCAATCATGTGAAACCAACGGCAC
+
#AAAFJJJJJJJJJJFJAJJJ<JJJJJJJJJJJJJF<JJJJJJFJJJFFJJJJ-AA<JJJJ-FFJJJJJJ7JJJJFJFJJJFAFF7JJJJJJJ<FJJFJJJJJF<A-7FA--77FJJJJJJ7FJ-7AFJFAFF<A7-A-FFFJF-)7FJJ
@K00124:681:HNKF3BBXX:5:1101:32086:1485 1:N:0:NAACAGGC
NCTGACCGTCTTGAAGTACTCACACGCCATCCAAAAGTCCAGGGTCTCCCCACTAAACTCGGTGCTCAGGAAGGACTGCCACACCTCGTCCTCTCACTTGCGACGTCTCTTCCTCTTCTGGGACTCGCGCCTGTTGAGAGCCTTCTGTGG
+
#-<AF---AFFJFJJFF7A7--FFJAFA--7----7-7-<A<--77F7--7-<<----7<F---A7-<<--FF---<77--77--7A-----7-7--7-A---77-777-<---7---7-----77-7---A-F-7<-----7--7---)

Last 8 lines of input FASTQ file: /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq
-------------------------
@K00124:681:HNKF3BBXX:5:2224:27976:73088 2:N:0:GNACAGGC
ANNATTTTGACTCCCCCCCCCCTCTTCCGCTTGTATTTTCCTTTGAGATGTGGTATTTTTTGGTTGGCTTTGTTTTTCTAGTTCNTCCGGATTCACTTTTTATCTCCCCTNCCCCCCTTTAAAGCTCCCCACATTTTTCTGTTGCTTTAA
+
-##<--AAAJJ---AFJ-FJJ--7A-7-7--77--FFJ--7-<-F<<-7<-<--AA-A-F---AA-<7--<<-F--7-------#7-----7-7-----7---7-7---7#----)-A)---7---7))-))7--77-7FJ----<<7--
@K00124:681:HNKF3BBXX:5:2224:29721:73088 2:N:0:GNACAGGC
CNNAACAGGAGGGAAAGGCTAAGAAAATNGCACAGGGGCAGGNTGACATANTAGCTAGTGNGTAGGACTGNGAAGGAATCTGATNGTTTCAGNATGGTACAAGGTGAAACNATTATATTTGATTTAGAGGAGGTTTAAGGATTNAGGGAA
+
A##AFJJJJJJJJJJJJJJJJJJJJJJJ#JJJFJJJJJJJJJ#JJJJJJJ#JJFJJJJJJ#J7JFFJFJF#JJJJJJFJ<FJJJ#JFJJJJJ#JJJJJJJJFJJJJFFJJ#FJ-<FJAFJFJF<FF<AA<AFF7-<FJFJJJ7#AF-7<F

Last 8 lines of input FASTQ file: /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq
-------------------------
@K00124:681:HNKF3BBXX:5:2224:27976:73088 1:N:0:GNACAGGC
GGGGCNTCCCCAGGTAATGGTGAATAAAGATCCCAAGATATTAGTTATACACTGGAGGTAAAAGAAAANCAATGTAGATTGAAACNGGTTACAANGCTCTCAAATAGACTTCTTCTGGAATAGACTTATAGANGATGTCTATTCCAGAAG
+
AA<FF#JJFJJJJJJJJFJF<FJJJJJJJJJJJJJFJJFJJJJJJJJJJJJJJJJFJJJJJJJJJJJJ#JJJFFJJJJJFFAJJJ#JJJJJFJJ#JFJAJJJJJJJ<FFJJJJJJJFAJAF<AFJJA<JJJ-#77AFJJJF<-77A<7A<
@K00124:681:HNKF3BBXX:5:2224:29721:73088 1:N:0:GNACAGGC
AGAAANTTATACAACCAGTCTGATGGATCCTACTTTAAAAATATAAGCACAGAGCANAAACAGGCACANTGTCTGGCAATCCTATNCTAANTTCNTCACTAGTTTGCTTTCCCNCTCTTGGAGGGACTACTCNACACATTTNCCTCAATC
+
AAFFF#JJJJJJJJJJJJJJJJJJJJJFJFJJJJJJJJJJJJJJJJJJJJJJJJJJ#JJJJJJJJJJF#JFJJJJJJJJJJJJJJ#JJJJ#JJJ#JJJJJJJJJJJJFJJJJF#JFJFJJ7FAFFFFJJJ7A#FFFFJ--7#A-<FF-FJ

Pair-reads overlappings:
------------------------
Input FASTQ file 1: /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq
Input FASTQ file 2: /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq
Length read 1: 150
Length read 2: 150
Minimum overlapping size considered by the program: 13
Total count pair-reads: 25625970 [100.000%]
Total count reads: 51251940 [200.000%]
Count pair-reads overlapping: 15696782 [61.253%]
Count total wasted nucleotides (due to overlappings): 1123549824 [14.615%]
Most common fragment size amont overlapping pair-reads: 257
Count of the most common fragment size among overlapping pair-reads: 166665

Fragment_length pair-reads_counts   pair-reads_percentage   Cumulative_pair-reads_percentage
14  162 0.001%  0.001%
15  165 0.001%  0.001%
16  169 0.001%  0.002%
17  180 0.001%  0.003%
18  176 0.001%  0.003%
19  280 0.001%  0.004%
20  3569    0.014%  0.018%
21  234 0.001%  0.019%
22  358 0.001%  0.021%
23  455 0.002%  0.022%
24  424 0.002%  0.024%
25  352 0.001%  0.025%
26  324 0.001%  0.027%
27  306 0.001%  0.028%
28  347 0.001%  0.029%
29  524 0.002%  0.031%
30  298 0.001%  0.032%
31  313 0.001%  0.034%
32  243 0.001%  0.035%
33  318 0.001%  0.036%
34  299 0.001%  0.037%
35  289 0.001%  0.038%
36  306 0.001%  0.039%
37  281 0.001%  0.040%
38  286 0.001%  0.042%
39  321 0.001%  0.043%
40  319 0.001%  0.044%
41  320 0.001%  0.045%
42  336 0.001%  0.047%
43  321 0.001%  0.048%
44  344 0.001%  0.049%
45  325 0.001%  0.051%
46  318 0.001%  0.052%
47  359 0.001%  0.053%
48  362 0.001%  0.055%
49  326 0.001%  0.056%
50  354 0.001%  0.057%
51  383 0.001%  0.059%
52  372 0.001%  0.060%
53  429 0.002%  0.062%
54  421 0.002%  0.063%
55  424 0.002%  0.065%
56  449 0.002%  0.067%
57  432 0.002%  0.069%
58  473 0.002%  0.070%
59  629 0.002%  0.073%
60  696 0.003%  0.076%
61  676 0.003%  0.078%
62  739 0.003%  0.081%
63  727 0.003%  0.084%
64  743 0.003%  0.087%
65  783 0.003%  0.090%
66  766 0.003%  0.093%
67  816 0.003%  0.096%
68  881 0.003%  0.100%
69  880 0.003%  0.103%
70  903 0.004%  0.106%
71  887 0.003%  0.110%
72  1013    0.004%  0.114%
73  1028    0.004%  0.118%
74  1016    0.004%  0.122%
75  1135    0.004%  0.126%
76  1222    0.005%  0.131%
77  1325    0.005%  0.136%
78  1404    0.005%  0.142%
79  1522    0.006%  0.148%
80  1553    0.006%  0.154%
81  1736    0.007%  0.160%
82  1893    0.007%  0.168%
83  1996    0.008%  0.176%
84  2043    0.008%  0.184%
85  2188    0.009%  0.192%
86  2404    0.009%  0.202%
87  2610    0.010%  0.212%
88  2768    0.011%  0.223%
89  2928    0.011%  0.234%
90  3270    0.013%  0.247%
91  3494    0.014%  0.260%
92  3724    0.015%  0.275%
93  3920    0.015%  0.290%
94  4217    0.016%  0.307%
95  4299    0.017%  0.323%
96  4472    0.017%  0.341%
97  4995    0.019%  0.360%
98  5230    0.020%  0.381%
99  5549    0.022%  0.402%
100 5704    0.022%  0.425%
101 5864    0.023%  0.448%
102 6051    0.024%  0.471%
103 6727    0.026%  0.497%
104 6669    0.026%  0.523%
105 7095    0.028%  0.551%
106 7450    0.029%  0.580%
107 7653    0.030%  0.610%
108 7973    0.031%  0.641%
109 8351    0.033%  0.674%
110 8477    0.033%  0.707%
111 9004    0.035%  0.742%
112 9362    0.037%  0.779%
113 9749    0.038%  0.817%
114 9695    0.038%  0.854%
115 10312   0.040%  0.895%
116 10436   0.041%  0.935%
117 10815   0.042%  0.978%
118 11416   0.045%  1.022%
119 11622   0.045%  1.067%
120 11951   0.047%  1.114%
121 12104   0.047%  1.161%
122 12696   0.050%  1.211%
123 13009   0.051%  1.262%
124 13522   0.053%  1.314%
125 13833   0.054%  1.368%
126 14294   0.056%  1.424%
127 14817   0.058%  1.482%
128 15050   0.059%  1.541%
129 15375   0.060%  1.601%
130 16134   0.063%  1.664%
131 16268   0.063%  1.727%
132 16780   0.065%  1.793%
133 17227   0.067%  1.860%
134 17808   0.069%  1.929%
135 17855   0.070%  1.999%
136 18833   0.073%  2.073%
137 19415   0.076%  2.148%
138 19554   0.076%  2.225%
139 20470   0.080%  2.304%
140 21078   0.082%  2.387%
141 21012   0.082%  2.469%
142 22174   0.087%  2.555%
143 23065   0.090%  2.645%
144 23275   0.091%  2.736%
145 23989   0.094%  2.830%
146 24144   0.094%  2.924%
147 25381   0.099%  3.023%
148 26246   0.102%  3.125%
149 26288   0.103%  3.228%
150 27194   0.106%  3.334%
151 28196   0.110%  3.444%
152 28216   0.110%  3.554%
153 29222   0.114%  3.668%
154 30250   0.118%  3.786%
155 30766   0.120%  3.906%
156 31880   0.124%  4.031%
157 32654   0.127%  4.158%
158 33065   0.129%  4.287%
159 34189   0.133%  4.421%
160 35289   0.138%  4.558%
161 35987   0.140%  4.699%
162 36818   0.144%  4.842%
163 38226   0.149%  4.992%
164 38970   0.152%  5.144%
165 39907   0.156%  5.299%
166 41314   0.161%  5.461%
167 41920   0.164%  5.624%
168 42837   0.167%  5.791%
169 43837   0.171%  5.962%
170 45170   0.176%  6.139%
171 46466   0.181%  6.320%
172 47225   0.184%  6.504%
173 48578   0.190%  6.694%
174 49723   0.194%  6.888%
175 51049   0.199%  7.087%
176 51706   0.202%  7.289%
177 53278   0.208%  7.497%
178 54769   0.214%  7.711%
179 55763   0.218%  7.928%
180 57251   0.223%  8.152%
181 58504   0.228%  8.380%
182 59973   0.234%  8.614%
183 61207   0.239%  8.853%
184 62723   0.245%  9.097%
185 65172   0.254%  9.352%
186 65679   0.256%  9.608%
187 67016   0.262%  9.870%
188 68372   0.267%  10.136%
189 69373   0.271%  10.407%
190 71211   0.278%  10.685%
191 73062   0.285%  10.970%
192 74662   0.291%  11.261%
193 76432   0.298%  11.560%
194 77988   0.304%  11.864%
195 80330   0.313%  12.178%
196 81596   0.318%  12.496%
197 82439   0.322%  12.818%
198 84946   0.331%  13.149%
199 86882   0.339%  13.488%
200 87999   0.343%  13.832%
201 89605   0.350%  14.181%
202 92387   0.361%  14.542%
203 92956   0.363%  14.905%
204 95550   0.373%  15.277%
205 97508   0.381%  15.658%
206 98566   0.385%  16.043%
207 100853  0.394%  16.436%
208 102646  0.401%  16.837%
209 103499  0.404%  17.241%
210 105860  0.413%  17.654%
211 108281  0.423%  18.076%
212 110245  0.430%  18.506%
213 111217  0.434%  18.940%
214 113919  0.445%  19.385%
215 114978  0.449%  19.834%
216 117062  0.457%  20.290%
217 118380  0.462%  20.752%
218 119763  0.467%  21.220%
219 121715  0.475%  21.695%
220 122422  0.478%  22.172%
221 125363  0.489%  22.662%
222 127019  0.496%  23.157%
223 128891  0.503%  23.660%
224 130706  0.510%  24.170%
225 133356  0.520%  24.691%
226 134307  0.524%  25.215%
227 136266  0.532%  25.747%
228 137541  0.537%  26.283%
229 138902  0.542%  26.825%
230 139823  0.546%  27.371%
231 140347  0.548%  27.919%
232 144135  0.562%  28.481%
233 144119  0.562%  29.043%
234 147135  0.574%  29.618%
235 148321  0.579%  30.196%
236 148573  0.580%  30.776%
237 150357  0.587%  31.363%
238 151849  0.593%  31.955%
239 153098  0.597%  32.553%
240 152820  0.596%  33.149%
241 155018  0.605%  33.754%
242 155421  0.606%  34.361%
243 156641  0.611%  34.972%
244 158244  0.618%  35.589%
245 158880  0.620%  36.209%
246 159882  0.624%  36.833%
247 160648  0.627%  37.460%
248 161049  0.628%  38.089%
249 162876  0.636%  38.724%
250 163928  0.640%  39.364%
251 163194  0.637%  40.001%
252 164412  0.642%  40.642%
253 166088  0.648%  41.291%
254 165258  0.645%  41.935%
255 165511  0.646%  42.581%
256 166424  0.649%  43.231%
257 166665  0.650%  43.881%
258 164966  0.644%  44.525%
259 164740  0.643%  45.168%
260 165449  0.646%  45.813%
261 162941  0.636%  46.449%
262 163703  0.639%  47.088%
263 163509  0.638%  47.726%
264 164398  0.642%  48.368%
265 164652  0.643%  49.010%
266 164621  0.642%  49.653%
267 163327  0.637%  50.290%
268 158725  0.619%  50.909%
269 157554  0.615%  51.524%
270 156842  0.612%  52.136%
271 155997  0.609%  52.745%
272 157471  0.614%  53.359%
273 154884  0.604%  53.964%
274 155807  0.608%  54.572%
275 153937  0.601%  55.172%
276 153739  0.600%  55.772%
277 151842  0.593%  56.365%
278 143878  0.561%  56.926%
279 142590  0.556%  57.483%
280 140884  0.550%  58.033%
281 141248  0.551%  58.584%
282 138564  0.541%  59.124%
283 137571  0.537%  59.661%
284 135673  0.529%  60.191%
285 137272  0.536%  60.726%
286 135040  0.527%  61.253%
>286    9929188 38.747% 100.000%

Adapters information:
--------------------
Reading the files for automated finding of adapters...
 -  /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-0_TZL38094_1.fq
 -  /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-1_TZL38094_2.fq
Adapter 3' end found!
   [AGATCGGAAGAGC...]
   [reverse-complement:...GCTCTTCCGATCT]
   [count=52579/3000000] (1.75263%)
Adapter 5' end found!
   [AGATCGGAAGAGC...]
   [reverse-complement:...GCTCTTCCGATCT]
   [count=52871/3000000 (1.76237%)]
NOTE: Too few adapters found in order to use several processes! Only one CPU will be used!
Using 1 process(es)...
Scanning for adapters...
Total count reads = 51250678
Count trimmed reads = 1639237 [3.198469%]
Count joined pair-reads = 817900 [3.191763%]
Count of fixed Ns = 25199

Reads (mate 1 from pair) removed because being marked as bad by Illumina:
-------------------------------------------------------------------------
0 (0.000%) reads out of 25625339 total reads were removed due to being labeled as bad quality by Illumina!

Reads (mate 2 from pair) removed because being marked as bad by Illumina:
-------------------------------------------------------------------------
0 (0.000%) reads out of 25625339 total reads were removed due to being labeled as bad quality by Illumina!

Total Count of reads (from all FASTQ files given as input and before any read removal is done, i.e. quality filtering, pre-processing):
--------------
/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/init-shuffle-sra-clear-noadapt-0_TZL38094.fq = 51250678

Fast pre-filtering:
-------------------
Time loading reference: 00:00:00
Time loading forward index: 00:00:00
Time loading mirror index: 00:00:01
Seeded quality full-index search: 00:02:58
# reads processed: 21709870
# reads with at least one reported alignment: 7904222 (36.41%)
# reads that failed to align: 13805648 (63.59%)
Reported 7904222 paired-end alignments
Time searching: 00:02:59
Overall time: 00:02:59

Length of all original reads:
-----------------------------
150
145
140
135
130
125
120
115
110
105
100
95
90
85
80
75
70
65
60
55
50
45
40
35
30

------------------------------------------------------------------------------------------------------
Total counts of all input/original reads (reads marked by Illumina as bad are not included here):
------------------------------------------------------------------------------------------------------
27611296

------------------------------------------------------------------------------------------------------

Input reads are broken up bioinformatically in smaller pieces due detection of very long reads!
----------------------

Total counts of all input reads (after breaking up them bioinformatically):
-------------------------------------------------------------------------------------------------
131177784

Length of all input reads (after breaking up them bioinformatically):
---------------------------------------------------------------------
92
91
90
89
88
87
86
85
84
83
82
81
80
79
78
77
76
75
74
73
72
71
70
69
68
67
66
65
64
63
62
61
60

Lengths of all reads after trimming:
------------------------------------
60

Found 158655 reads with poly-A/C/G/T/N tails (equal or more 16 repeat nucleotides)
Total number of input reads = 131177784
Total number of reads written in the output = 131165629

Count of all short reads after removing reads due to missing their mate read:
-----------------------------------------------------------------------------
130861818

============
MEMORY (before using BOWTIE):
============
              total        used        free      shared  buff/cache   available
Mem:         515885      125522      200253           7      190109      387393
Swap:          8191        1075        7116

Mapping all input reads on rRNA and/or MT for filtering purposes:
----------------------------------------------------------------
Time loading forward index: 00:00:00
Time loading mirror index: 00:00:00
Seeded quality full-index search: 00:08:36
# reads processed: 130861818
# reads with at least one reported alignment: 1010540 (0.77%)
# reads that failed to align: 129851278 (99.23%)
Reported 1010540 alignments
Time searching: 00:08:36
Overall time: 00:08:36

Count of all short reads after removing reads due to missing their mate read:
-----------------------------------------------------------------------------
129637462

Total Reads Counts (after the all filtering steps):
---------------------------------------------------
129637462
ndaniel commented 3 years ago

Shortly, bowtie v1.2.3 crashes. It is not clear why Bowtie is crashing.

ERROR: Workflow execution failed at step 146 while executing:
----------------
   bowtie \
   --seed 123456 \
   -t  \
   -k 200 \
   -v 0 \
   -p 5 \
   -m 20 \
   --suppress 5,6,7 \
   --phred33-quals  \
   --best  \
   --strata  \
   --chunkmbs 128 \
   --un /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_filtered_not-mapped-genome.fq \
   --max /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered_multiple-mappings-genome.fq \
    /lab_data/avery_lab/reference_files/fc_cf_2020_1_5/genome_index2/index \
    /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered.fq \
    /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_filtered_genome.map \
   2> /lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/log_bowtie_reads_mapped-genome.stdout.txt
----------------
  * Size '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_filtered_not-mapped-genome.fq' = 3478538115 bytes
  * Size '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered_multiple-mappings-genome.fq' = 43159635 bytes
  * Size '/lab_data/avery_lab/reference_files/fc_cf_2020_1_5/genome_index2/index' = 0 bytes
  * Size '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads-filtered.fq' = 17501057370 bytes
  * Size '/lab_data/avery_lab/tmp_files/tzn_evan/fc/TZL38094/reads_filtered_genome.map' = 1565032448 bytes
Time loading forward index: 00:00:03
ndaniel commented 3 years ago

Try to run FusionCatcher v1.30 that was releaased few day ago and see if this error shows up again!