search

ndaniel / fusioncatcher

Finder of Somatic Fusion Genes in RNA-seq data
GNU General Public License v3.0
141 stars 66 forks source link

Error message shared.KillSwitch.kill #191

Open Coaxecva opened 2 years ago

Coaxecva commented 2 years ago

Hi Daniel,

I got this error message for some samples:

Memory: max=211237m, total=211237m, free=207740m, used=3497m

Input is being processed as paired
Started output streams: 0.070 seconds.
Warning! Changed from ASCII-33 to ASCII-64 on input ;: 59 -> 28
Up to 277350 prior reads may have been generated with incorrect qualities.
If this is a problem you may wish to re-run with the flag 'qin=33' or 'qin=64'.

The ASCII quality encoding offset (64) is not set correctly, or the reads are corrupt; quality value below -5.
Please re-run with the flag 'qin=33', 'ignorebadquality', or '-da'.
Problematic read number 277351:

@HWI-ST173R:607:D1C5FACXX:8:1106:4415:59068/1
GCCCAGAGAGGTTCACTCCCCATCCTGTACCAGTTTCATCATGAGGATGCTGCCCTGGAGCGTAGGTCGGCCAACTCTGCAGGGCAGCATCCTCATGATG
+
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@CCHBDCC@@@CCCDDC@@@@@BDDDCCAC@@C@@@

Offset=64
java.lang.Exception: Aborting.
        at shared.KillSwitch.kill(KillSwitch.java:108)
        at stream.FASTQ.quadToRead_slow(FASTQ.java:754)
        at stream.FASTQ.toReadList(FASTQ.java:625)
        at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:107)
        at stream.FastqReadInputStream.nextList(FastqReadInputStream.java:93)
        at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:680)
        at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:656)

Wonder if you can see what caused the error?

Thanks, Coax

ndaniel commented 2 years ago

Hi @Coaxecva

FusionCatcher runs several external tools and programs. Here it looks like one of them is failing but it is not clear which one. That information is in fusioncatcher.log . So providing that file might help!

Coaxecva commented 2 years ago

Please find the log file attached.

Thanks,

CoaxSAMPLE.log

ndaniel commented 2 years ago

The error comes from bbduk.sh that is part of BBMap.

BBduk basicaly complains that is something wrong with the input FASTQ file, more precisely

Problematic read number 277351:

@HWI-ST173R:607:D1C5FACXX:8:1106:4415:59068/1
GCCCAGAGAGGTTCACTCCCCATCCTGTACCAGTTTCATCATGAGGATGCTGCCCTGGAGCGTAGGTCGGCCAACTCTGCAGGGCAGCATCCTCATGATG
+
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@CCHBDCC@@@CCCDDC@@@@@BDDDCCAC@@C@@@

Is the input FASTQ file ok?

Coaxecva commented 2 years ago

The read pairs from fastq files are below. The read R2 got trimmed. Do you allow fusioncatcher work with different lengths from R1 and R2?

Total number of lines in R1 and R2: 41644668 == 10411167 read pairs. 

@HWI-ST173R:607:D1C5FACXX:8:1106:4415:59068/1
GCCCAGAGAGGTTCACTCCCCATCCTGTACCAGTTTCATCATGAGGATGCTGCCCTGGAGCGTAGGTCGGCCAACTCTGCAGGGCAGCATCCTCATGATG
+
@@@FFFFFGHHFFHHIJJJJJEHGHJIGGEHGIHIIGGIJIJJIHEC;<?DHIJHGIGFHGH/5=CCHBDCC6=@CCCDDC:<;?@BDDDCCAC@>C:>@

@HWI-ST173R:607:D1C5FACXX:8:1106:4415:59068/2
ACCCAGAGAGGTTCACTCCCCATCCTGTACCAGTTTCATCATGAGGATGCTGCCCTGCAGAGTTGGCCGACCTACGCTCCAGGGCAGC
+
C@@CFFFFFHH:AFHIJJJJJJIJIHGHIJJHI?C?F@GG?GEGGHH>FAB<BGHEC=FGGGA@FFCEEEED>C>>BB##########
Coaxecva commented 2 years ago

Hi @ndaniel

Please find the fastq files: https://www.dropbox.com/s/zgse1sny96yixug/my_read_R1.fastq.gz?dl=0 https://www.dropbox.com/s/dfn0syuyibrsym9/my_read_R2.fastq.gz?dl=0

Coax

ndaniel commented 2 years ago

Hi @Coaxecva

I am able to reproduce the issue. For some reason BBDUK guesses wrong the qualities in the FASTQ file. Until this bug is fixed in FusionCatcher and BBDUK one may use this command line parameter --skip-trim-multiple-5 as work around.