Could not locate a Bowtie index rtrna_mt_index

[2015kiran]

Hi Daniel,

i am using Fusioncatcher, 0.99.4b version i could run fine on the test samples with the same build Ensembl 79 vesion. but when i ran with my RNA-seqdata, half way it threw Error saying could;t locate rna_index which was't there even when i ran with test samples,

How to Manipulate to skip some steps in fusioncatcher so it will be user friendly...? like to skip Bowtie of rtrna.

How and where to reduce the Threads used by Fusion catcher.. as it is now -p 64..?

here is my Info.txt cant attach file..

https://code.google.com/p/fusioncatcher/wiki/Manual_v0_93#FUSIONCATCHER # Issues cannot be reported in the above link anymore..

----------------

   bowtie \
   -t  \
   -v 2 \
   -p 64 \
   -k 1 \
   --solexa1.3-quals  \
   --tryhard  \
   --chunkmbs 128 \
   --un /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19/reads-filtered_temp.fq \
   --max /dev/null \
    /data/current/rtrna_mt_index/ \
    /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19/reads_acgt.fq \
    /dev/null \
   2> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19/log_bowtie_reads-filtered-out.stdout.txt
----------------
  * Size '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19/reads-filtered_temp.fq' = 0 bytes
  * Size '/data/current/rtrna_mt_index/' = 0 bytes
  * Size '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19/reads_acgt.fq' = 27456195340 bytes
  * Size '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19/log_bowtie_reads-filtered-out.stdout.txt' = 400 bytes
Could not locate a Bowtie index corresponding to basename "/data/current/rtrna_mt_index/"
Overall time: 00:00:00
Command: bowtie -t -v 2 -p 64 -k 1 --solexa1.3-quals --tryhard --chunkmbs 128 --un /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19/reads-filtered_temp.fq --max /dev/null /data/current/rtrna_mt_index/ /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19/reads_acgt.fq /dev/null 

----------

Found 40405 reads with poly-A/C/G/T/N tails (equal or more 20 repeat nucleotides)
Total number of input reads = 117508227
Total number of reads written in the output = 117495305
Count of all short reads after removing reads due to missing their mate read:
-----------------------------------------------------------------------------
104396180
Adjusted automatically mismatches_psl and trim_psl_3end_keep (105,3) because reads of maximum length of 125 bp were found!.

What need to be done continue the further steps..

Thank you

[ndaniel]

Hi!

I am using Fusioncatcher, 0.99.4b version i could run fine on the test samples with the same build Ensembl 79 vesion. but when i ran with my RNA-seqdata, half way it threw Error saying could;t locate rna_index which was't there even when i ran with test samples,

Please, could you attach here or send me by email the logs of the run (ie. fusioncatcher.log and info.txt)?

How to Manipulate to skip some steps in fusioncatcher so it will be user friendly...? like to skip Bowtie of rtrna.

That cannot be skipped and also it is not recommended to be skipped because it will increase the number of false positives for finding fusion genes. The issue which is reported here looks like it has something to do with the installation and therefore it might be that even if this step would be skipped it would just kick the can further without solving the main problem.

How and where to reduce the Threads used by Fusion catcher.. as it is now -p 64..?

For example, if one wants to use 2 threads then FusionCatcher should be run using the command line option -p=2.

here is my Info.txt cant attach file.. https://code.google.com/p/fusioncatcher/wiki/Manual_v0_93#FUSIONCATCHER # Issues cannot be reported in the above link anymore..

Indeed the issues cannot be reported anymore on Google Code which was the original website of FusionCatcher because Google Code will be shutdown soon by Google. Therefore the official website of FusionCatcher has been moved to GitHub but the (i) release files and (ii) the human build files (which are very large, ie. >25GB) are hosted and will be hosted on sourceforge.net

The error message which might have some relevance here is:

Could not locate a Bowtie index corresponding to basename "/data/current/rtrna_mt_index/"

and there the path /data/current/rtrna_mt_index/ looks very weird which might indicate that the installation didn't go well.

Would be possible to submit the logs of this run (ie. text files: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19/fusioncatcher.log and /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19/info.txt) in order to figure out what went wrong?

[2015kiran]

Hi Daniel, Unfortunately only files with extension PNG, GIF and JPG are supported here to attach,

We dont get any alerts on reply to this query as google code.. here is my Info.txt

================================================
Sotware version: fusioncatcher.py 0.99.4b beta
================================================
===================================
GENOME INFORMATION:
===================================

================================================================================
WARNING: This is an OLD version of FusionCatcher! There is a newer
         version available! Please, update to the newest version!
 - Current version:   0.99.4b beta
 - New version:       0.99.4c beta
================================================================================

===================================
Genome FASTA files:
===================================

================================================================================
WARNING: This is an OLD version of FusionCatcher! There is a newer
         version available! Please, update to the newest version!
 - Current version:   0.99.4b beta
 - New version:       0.99.4c beta
================================================================================

Linux:
------
Red Hat Enterprise Linux Server release 6.5 (Santiago)
Kernel \r on an \m

Python:
------
Python version: 2.6.6 (r266:84292, Sep  4 2013, 07:46:00) 
[GCC 4.4.7 20120313 (Red Hat 4.4.7-3)]
Python executable: /usr/bin/python

BioPython:
------
1.65

===========
TOOLS:
===========

SORT:
------
sort (GNU coreutils) 8.4

BOWTIE:
------
bowtie version 1.1.1
64-bit

PIGZ:
------
pigz 2.3.1

fastq-dump (from SRA Toolkit):
--------------
fastq-dump : 2.4.2

SAMTools:
---------
Version: 0.1.19-44428cd

liftOver:
---------
liftOver - Move annotations from one assembly to another

SeqTK:
---------
Version: 1.0-r68e-dirty

sed:
---------
GNU sed version 4.2.1

awk:
---------
GNU Awk 3.1.7

BLAT:
------
blat - Standalone BLAT v. 35x1 fast sequence search command line tool

faToTwoBit (from BLAT toolbox):
----------------
faToTwoBit - Convert DNA from fasta to 2bit format

STAR:
------
STAR_2.4.1c

Pipeline parameters:
====================
aligners = blat,star
all_reads_junction = False
ambiguous_mismatches = 2
assembly = False
batch_mode = False
biotypes = 7skrna,ambiguous,banned,bodymap2,conjoing,cta_gene,ctb_gene,ctc_gene,ctd_gene,distance1000bp,ensembl_fully_overlapping,ensembl_same_strand_overlapping,healthy,metazoa,mirna,mt,pair_pseudo_genes,paralogs,refseq_fully_overlapping,refseq_same_strand_overlapping,removed,rp11_gene,rp_gene,rrna,similar_reads,similar_symbols,snorna,snrna,trna,yrna
checksums_filename = checksums.txt
chunkmbs = 128
configuration_filename = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/etc/configuration.cfg,/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/bin/configuration.cfg
data_directory = /data/current/
extract_buffer_size = 2000000000
filter_mismatches = 2
hash = no
highly_sensitive = False
homolog = 1.25e-05
input_filename = /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB.RI.T40_R1.fastq.gz,/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB.RI.T40_R2.fastq.gz
keep_temporary_files = False
keep_unmapped_reads = False
keep_viruses = False
length_anchor = 17,17,17,17,17
length_anchor2 = 47
limit_blat = 3221225472
limit_bowtie = 4294867296
limit_bowtie2 = 30000000
limit_bwa = 1
limit_star = 30000000
mildly_sensitive = False
min_dist = 200000
mismatches = 2
mismatches_psl = 2
no_seqtk_subseq = False
output_directory = /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40
paranoid_sensitive = False
processes = 64
psl_visualization = False
sam_visualization = True
sensitive = False
skip_adapter_filtering = False
skip_ambiguous_filtering = False
skip_automatic_scaling = False
skip_b_filtering = False
skip_banned_fusions = False
skip_blat = False
skip_bowtie2 = True
skip_bwa = True
skip_compress_ids = False
skip_conversion_grch37 = False
skip_hla_filtering = False
skip_interleave_processing = False
skip_known_fusions = False
skip_mitochondrion_filtering = False
skip_phix174_filtering = False
skip_prefiltering_psl = False
skip_readthroughs = False
skip_star = False
skip_star_bowtie = False
skip_str_filtering = False
skip_update_check = False
skip_viruses_filtering = False
spanning_pairs = 3,3,3,3,3
spanning_pairs_count = 10000
spanning_reads = 2,2,2,2,2
start_step = 0
tmp_directory = /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/tmp
trim_3end = 0
trim_3end_keep = 0
trim_5end = 0
trim_psl = False
trim_psl_3end_keep = 82
trim_psl_5end = False
trim_quality = 5
trim_wiggle = 0
main_script = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/bin/fusioncatcher.py
main_script_version = fusioncatcher.py 0.99.4b beta

Current working directory:
---------------------------
/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher

Command line used for launching FusionCatcher:
----------------------------------------------
bin/fusioncatcher.py \ 
--visualization-sam \ 
--5keep \ 
0 \ 
-d \ 
/data/current/ \ 
-i \ 
/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB.RI.T40_R1.fastq.gz,/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB.RI.T40_R2.fastq.gz \ 
-o \ 
/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40
----------------------------------------------

===================
CONFIGURATION.CFG:
===================
[paths]
python = /usr/bin
data = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/data/ensembl_v79b
scripts = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/bin
bowtie = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/bowtie
bowtie2 = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/bowtie2
bwa = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/bwa
blat = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/blat
liftover = /opt/kent/liftOver
star = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/star/source
velvet = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/velvet
fatotwobit = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/fatotwobit
samtools = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/samtools
seqtk = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/seqtk
sra = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/sratoolkit/bin
numpy = /usr/lib64/python2.6/site-packages/numpy
biopython = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/biopython
xlrd = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/xlrd
openpyxl = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/openpyxl
lzo = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/lzo
lzop = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/lzop/src
coreutils = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/coreutils/src
pigz = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/pigz
picard = /MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/tools/picard
java = /usr/bin

[paths]
fusioncatcher = 0.99.4b beta

============
DATA DIRECTORY:
============
/data/current/
It is not a link!

================================================================================
WARNING: This is an OLD version of FusionCatcher! There is a newer
         version available! Please, update to the newest version!
 - Current version:   0.99.4b beta
 - New version:       0.99.4c beta
================================================================================

============
MEMORY:
============
             total       used       free     shared    buffers     cached
Mem:        258276      60783     197493          0         11      26997
-/+ buffers/cache:      33774     224502
Swap:        31999          2      31997

Total installed RAM memory = 258276 MB

Input files (which contain the short reads):
--------------------------------------------
/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB.RI.T40_R1.fastq.gz
/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB.RI.T40_R2.fastq.gz

First 8 lines of input FASTQ file: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq
-------------------------
@HWI-D00464:61:C66DDACXX:7:1101:1337:2042 2:N:0:GTCCGCA
NTTCTTCTTTCAAAGTCATACTTCAACAAAGTTGCTATTGAATATGTCTGACTAAACATGTTAGCTATATGATAAGATGGCTGGATAAGAGATAAATATA
+
#0<0BFFFFFFFFBFFFIIIIIIFFFFIIIIBFFIFFFIFBBFBFFFFIIFIFFFIFIIFFFIIIIFFBFFFIIBFFFFIIIIFBFFFFBFBBFBBFBBF
@HWI-D00464:61:C66DDACXX:7:1101:1356:2065 2:N:0:GTCCGCA
GGCTGACCGGATGGTTGAAAAAGGCCATTTTGCTGAGCTCTCACAGCTGCTAGGGATGCTCAATGACTCCCAATACAACCCAAAGAGACAAACGCTTGTT
+
<<7<7'0'<77<0<<7'0'<<7'''<0<BBB000<7<<B7<7'7707<7'770''0<BBB########################################

First 8 lines of input FASTQ file: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq
-------------------------
@HWI-D00464:61:C66DDACXX:7:1101:1337:2042 1:N:0:GTCCGCA
NTTATAAATTTCTTAGTAGATTTATGTCTAAATATTTTACGGTTTGCTACTATTATGAATCAAATAGTTATTAGTTTTCCATTTTAATTCCTAAAGGGTT
+
#0<BFFFFFFFFFIIIFIB<BFFFFIIIIFFBFFIFFFBFFFFFFIFFFFIBFFFIFBFFBFFFFIIFFFFIIIFFFFBBFFFFF<BFFFFFFB<BBB<B
@HWI-D00464:61:C66DDACXX:7:1101:1356:2065 1:N:0:GTCCGCA
NTTCTTATGAAGGATTCGAGCAGGAGCCTGATGCACCAGGGTGAGTGTGGCAGAAAAAACAAGCGTTTGTCTCTTTGGGTTGTATTGGGAGTCATTGAGC
+
#0<BBF<BBFBBFB<F<FF<BF<F0B7<BBFFBBF<B7B70007B0077B<BBBFFB<B0<7B<B7<B77<<<'<<<<77<770<BB<<777<BB<<<<B

Last 8 lines of input FASTQ file: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq
-------------------------
@HWI-D00464:61:C66DDACXX:7:2316:21241:100858 2:N:0:GTCCGCA
CAGCCACTGGAGCACTTGGGAGTACCAGTACACGTCACTACACCTGGCTAATTTTTTGTATTTTTAGTAGAGAGGGGGTTTTGCCGAGTTGTACAGGCTG
+
<7<<<B'<<B7B0<<<'<<B<'<77<<B7<<BBB0070'<<<<BBBB0<<<777<<<B<<B<<0<7<<<B<B############################
@HWI-D00464:61:C66DDACXX:7:2316:21275:100842 2:N:0:GTCCGAA
TGTACCAAGATTGAGAAACCTGTCTCAAGACAACGTGCATTGTTTTTATCTGGTTGCTCTCAAGATTATCTCTTTACAACTATAGTTTTCAGAGATCGGA
+
<B<BBFBFFFBFBBBBFFBBBB<BBFFFFF<BFFFBFBFFBFFFFFIFBFBFFFFFFF<FFB<FFBFBFFFIF<<07B<BF<0<B<<BBBBB<B0<BBBB

Last 8 lines of input FASTQ file: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq
-------------------------
@HWI-D00464:61:C66DDACXX:7:2316:21241:100858 1:N:0:GTCCGCA
CTCGACAAATCAACTTTTTTAGGCCAGGTGTGGTGGCTCACGCCCGTAATCCCAACACTTTGGGAGGCTGAGGCAGGCAGATCACCTGAGTCCAGGAGTN
+
0<0000<BBBB<BBBBBBBFBFIFFFFI7B<BF0BF<BBFBFBBBFBBFBBFFFFB<BBBFBBBBBBBBBBBBBBBBB<BBB<BB7<BBB<BBBBBBB##
@HWI-D00464:61:C66DDACXX:7:2316:21275:100842 1:N:0:GTCCGAA
CTGAAAACTATAGTTGTAAAGAGATAATCTTGAGAGCAACCAGATAAAAACAATGCACGTTGTCTTGAGACAGGTTTCTCAATCTTGGTACAAGATCGGN
+
<<BBB<BFBBB<FBBF<<BFIFFBB<<BFF<FFFFFFBBFBFFI<FFFBBBFFBBFBFFBFFFBBFFFFFFFFF7<BB<BBBFFBBBBBBBBBBBB<BB#

Pair-reads overlappings:
------------------------
Input FASTQ file 1: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq
Input FASTQ file 2: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq
Length read 1: 100
Length read 2: 100
Minimum overlapping size considered by the program: 15
Total count pair-reads: 67248746 [100.000%]
Total count reads: 134497492 [200.000%]
Count pair-reads overlapping: 51038121 [75.895%]
Count total wasted nucleotides (due to overlappings): 3229164183 [24.009%]
Most common fragment size amont overlapping pair-reads: 126
Count of the most common fragment size among overlapping pair-reads: 804551

Fragment_length pair-reads_counts   pair-reads_percentage   Cumulative_pair-reads_percentage
18  2260    0.003%  0.003%
19  2193    0.003%  0.007%
20  2063    0.003%  0.010%
21  2485    0.004%  0.013%
22  2302    0.003%  0.017%
23  2190    0.003%  0.020%
24  2247    0.003%  0.023%
25  3395    0.005%  0.028%
26  2341    0.003%  0.032%
27  2554    0.004%  0.036%
28  2663    0.004%  0.040%
29  2685    0.004%  0.044%
30  2710    0.004%  0.048%
31  2756    0.004%  0.052%
32  2672    0.004%  0.056%
33  2586    0.004%  0.060%
34  2726    0.004%  0.064%
35  2733    0.004%  0.068%
36  2767    0.004%  0.072%
37  3139    0.005%  0.077%
38  3105    0.005%  0.081%
39  3061    0.005%  0.086%
40  3128    0.005%  0.090%
41  2977    0.004%  0.095%
42  2981    0.004%  0.099%
43  2927    0.004%  0.104%
44  2952    0.004%  0.108%
45  3098    0.005%  0.113%
46  3041    0.005%  0.117%
47  3232    0.005%  0.122%
48  3292    0.005%  0.127%
49  3295    0.005%  0.132%
50  3489    0.005%  0.137%
51  3492    0.005%  0.142%
52  3518    0.005%  0.147%
53  3607    0.005%  0.153%
54  3516    0.005%  0.158%
55  3607    0.005%  0.163%
56  3585    0.005%  0.169%
57  3768    0.006%  0.174%
58  3842    0.006%  0.180%
59  4032    0.006%  0.186%
60  4506    0.007%  0.193%
61  5123    0.008%  0.200%
62  5108    0.008%  0.208%
63  5408    0.008%  0.216%
64  5751    0.009%  0.224%
65  6113    0.009%  0.233%
66  6441    0.010%  0.243%
67  6854    0.010%  0.253%
68  7260    0.011%  0.264%
69  7875    0.012%  0.276%
70  8700    0.013%  0.289%
71  9550    0.014%  0.303%
72  11066   0.016%  0.319%
73  12347   0.018%  0.338%
74  13878   0.021%  0.358%
75  15793   0.023%  0.382%
76  15810   0.024%  0.405%
77  18339   0.027%  0.433%
78  19936   0.030%  0.462%
79  23106   0.034%  0.497%
80  26206   0.039%  0.536%
81  29999   0.045%  0.580%
82  33967   0.051%  0.631%
83  39868   0.059%  0.690%
84  44334   0.066%  0.756%
85  51243   0.076%  0.832%
86  57159   0.085%  0.917%
87  63511   0.094%  1.012%
88  68315   0.102%  1.113%
89  74196   0.110%  1.223%
90  83346   0.124%  1.347%
91  99122   0.147%  1.495%
92  109138  0.162%  1.657%
93  132354  0.197%  1.854%
94  142493  0.212%  2.066%
95  161024  0.239%  2.305%
96  182111  0.271%  2.576%
97  192809  0.287%  2.863%
98  219411  0.326%  3.189%
99  230816  0.343%  3.532%
100 257211  0.382%  3.915%
101 287137  0.427%  4.342%
102 329062  0.489%  4.831%
103 341602  0.508%  5.339%
104 372476  0.554%  5.893%
105 391284  0.582%  6.475%
106 434759  0.646%  7.121%
107 441100  0.656%  7.777%
108 463774  0.690%  8.467%
109 500414  0.744%  9.211%
110 542413  0.807%  10.017%
111 547553  0.814%  10.832%
112 576472  0.857%  11.689%
113 612038  0.910%  12.599%
114 645374  0.960%  13.559%
115 667309  0.992%  14.551%
116 695723  1.035%  15.586%
117 724514  1.077%  16.663%
118 713465  1.061%  17.724%
119 701869  1.044%  18.768%
120 710874  1.057%  19.825%
121 725885  1.079%  20.904%
122 741321  1.102%  22.006%
123 747960  1.112%  23.119%
124 781371  1.162%  24.281%
125 801325  1.192%  25.472%
126 804551  1.196%  26.669%
127 801198  1.191%  27.860%
128 801935  1.192%  29.052%
129 779036  1.158%  30.211%
130 787899  1.172%  31.382%
131 773474  1.150%  32.533%
132 774100  1.151%  33.684%
133 761366  1.132%  34.816%
134 783848  1.166%  35.981%
135 776254  1.154%  37.136%
136 778937  1.158%  38.294%
137 768682  1.143%  39.437%
138 757944  1.127%  40.564%
139 750922  1.117%  41.681%
140 727927  1.082%  42.763%
141 723065  1.075%  43.838%
142 728694  1.084%  44.922%
143 712443  1.059%  45.981%
144 745475  1.109%  47.090%
145 762486  1.134%  48.224%
146 721872  1.073%  49.297%
147 703064  1.045%  50.343%
148 682273  1.015%  51.357%
149 679153  1.010%  52.367%
150 637389  0.948%  53.315%
151 635048  0.944%  54.259%
152 610624  0.908%  55.167%
153 615929  0.916%  56.083%
154 598097  0.889%  56.973%
155 611455  0.909%  57.882%
156 580156  0.863%  58.745%
157 566577  0.843%  59.587%
158 562129  0.836%  60.423%
159 553132  0.823%  61.245%
160 565009  0.840%  62.086%
161 548311  0.815%  62.901%
162 522347  0.777%  63.678%
163 517433  0.769%  64.447%
164 491598  0.731%  65.178%
165 491652  0.731%  65.909%
166 486718  0.724%  66.633%
167 483837  0.719%  67.353%
168 455958  0.678%  68.031%
169 445667  0.663%  68.693%
170 433840  0.645%  69.338%
171 415577  0.618%  69.956%
172 400158  0.595%  70.551%
173 399617  0.594%  71.146%
174 380927  0.566%  71.712%
175 373052  0.555%  72.267%
176 376231  0.559%  72.826%
177 361912  0.538%  73.364%
178 358852  0.534%  73.898%
179 346233  0.515%  74.413%
180 331185  0.492%  74.905%
181 324288  0.482%  75.388%
182 340902  0.507%  75.895%
>182    16210625    24.105% 100.000%

Adapters information:
--------------------
Reading the files for automated finding of adapters...
 -  /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq
 -  /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq
Adapter 3' end found!
   [AGATCGGAAGAGC...]
   [reverse-complement:...GCTCTTCCGATCT]
   [count=22482/3000000] (0.74940%)
Adapter 5' end found!
   [AGATCGGAAGAGC...]
   [reverse-complement:...GCTCTTCCGATCT]
   [count=22386/3000000 (0.74620%)]
NOTE: Too few adapters found in order to use several processes! Only one CPU will be used!
Using 1 process(es)...
Scanning for adapters...
   10000000 pair-reads [ 722659 (3.613295%) reads trimmed ]
   20000000 pair-reads [ 1437460 (3.593650%) reads trimmed ]
   30000000 pair-reads [ 2147615 (3.579358%) reads trimmed ]
   40000000 pair-reads [ 2863730 (3.579662%) reads trimmed ]
   50000000 pair-reads [ 3572218 (3.572218%) reads trimmed ]
   60000000 pair-reads [ 4282831 (3.569026%) reads trimmed ]
Total count reads = 134495738
Count trimmed reads = 4796244 [3.566094%]
Count joined pair-reads = 2504472 [3.724240%]
Count of fixed Ns = 17039

Reads (mate 1 from pair) removed because being marked as bad by Illumina:
-------------------------------------------------------------------------
0 (0.000%) reads out of 67247869 total reads were removed due to being labeled as bad quality by Illumina!

Reads (mate 2 from pair) removed because being marked as bad by Illumina:
-------------------------------------------------------------------------
0 (0.000%) reads out of 67247869 total reads were removed due to being labeled as bad quality by Illumina!

Total Count of reads (from all FASTQ files given as input and before any read removal is done, i.e. quality filtering, pre-processing):
--------------
/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-shuffle-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq = 134495738

Length of all original reads:
-----------------------------
100
99
98
97
96
95
94
93
92
91
90
89
88
87
86
85
84
83
82
81
80
79
78
77
76
75
74
73
72
71
70
69
68
67
66
65
64
63
62
61
60
59
58
57
56
55
54
53
52
51
50
49
48
47
46
45
44
43
42
41
40
39
38
37
36
35
34
33
32
31
30
29
28
27
26
25
24
23
22
21
20
1

Total counts of all original reads (after the reads marked by Illumina as bad have been removed):
-------------------------------------------------------------------------------------------------
134495738

Lengths of all reads after trimming:
------------------------------------
100
99
98
97
96
95
94
93
92
91
90
89
88
87
86
85
84
83
82
81
80
79
78
77
76
75
74
73
72
71
70
69
68
67
66
65
64
63
62
61
60
59
58
57
56
55
54
53
52
51
50
49
48
47
46
45
44
43
42
41
40
39
38
37
36
35
34
33
32
31
30
29
28
27
26
25
24
23
22
21
20
1

================================================================================
WARNING: This is an OLD version of FusionCatcher! There is a newer
         version available! Please, update to the newest version!
 - Current version:   0.99.4b beta
 - New version:       0.99.4c beta
================================================================================

Found 89490 reads with poly-A/C/G/T/N tails (equal or more 20 repeat nucleotides)
Total number of input reads = 119283138
Total number of reads written in the output = 119222860
Count of all short reads after removing reads due to missing their mate read:
-----------------------------------------------------------------------------
112660512

============
MEMORY (before using BOWTIE):
============
             total       used       free     shared    buffers     cached
Mem:        193654      67585     126068          0          7      46241
-/+ buffers/cache:      21336     172317
Swap:        31999      10432      21567

------------
fusion.log
--------
Log of the pipeline:
--------------------------------------------------------------------------------
Starting execution with step 96.
////////////////////////////////////////////////////////////////////////////////
  Running: step = 1   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
================================================
Sotware version: fusioncatcher.py 0.99.4b beta
================================================
"  \
> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 2   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
Sotware version: fusioncatcher.py 0.99.4b beta
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/fusioncatcher.log
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 3   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:0m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 4   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 5   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Skipping from erasing '/data/current/version.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 6   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 7   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Skipping from erasing '/data/current/genome_information.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 8   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
Linux:
------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 9   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
cat \
/etc/issue  \
2>&1  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 10   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
Python:
------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 11   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
python_version.py \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 12   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
BioPython:
------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 13   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
biopython_version.py \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 14   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
===========
TOOLS:
===========
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 15   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
SORT:
------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 16   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
sort \
--version  \
|  \
head -1 \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 17   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
BOWTIE:
------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 18   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
bowtie \
--version  \
|  \
head -2 \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 19   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
PIGZ:
------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 20   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
pigz \
-V  \
2>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 21   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
fastq-dump (from SRA Toolkit):
--------------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 22   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
fastq-dump \
2>&1  \
|  \
tail -2 \
|  \
head -1 \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 23   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
SAMTools:
---------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 24   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
samtools \
2>&1  \
|  \
head -3 \
|  \
tail -1 \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 25   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
liftOver:
---------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 26   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
liftOver \
2>&1  \
|  \
head -1 \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 27   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
SeqTK:
---------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 28   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
seqtk \
2>&1  \
|  \
head -3 \
|  \
tail -1 \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 29   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
sed:
---------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 30   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
sed \
--version  \
2>&1  \
|  \
head -1 \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 31   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
awk:
---------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 32   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
awk \
--version  \
2>&1  \
|  \
head -1 \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 33   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
BLAT:
------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 34   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
blat \
|  \
head -1 \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 35   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
faToTwoBit (from BLAT toolbox):
----------------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 36   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
faToTwoBit \
2>&1  \
> /dev/null \
|  \
head -1 \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 37   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
STAR:
------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 38   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
STAR \
--version  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 39   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"

"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 40   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 41   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 42   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Skipping from erasing '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher/etc/configuration.cfg' (size: 1510 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 43   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
============
DATA DIRECTORY:
============
/data/current/
It is not a link!

"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 44   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 45   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
============
MEMORY:
============
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 46   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
free \
-m  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 47   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
Total installed RAM memory = 193654 MB"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 48   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"

"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
Input files (which contain the short reads):
/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB.RI.T40_R1.fastq.gz
/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB.RI.T40_R2.fastq.gz
////////////////////////////////////////////////////////////////////////////////
  Running: step = 49   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 50   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
pigz \
-p 64 \
-d  \
-f  \
-c  \
 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB.RI.T40_R1.fastq.gz \
> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 51   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
pigz \
-p 64 \
-d  \
-f  \
-c  \
 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB.RI.T40_R2.fastq.gz \
> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 52   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"

First 8 lines of input FASTQ file: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq
-------------------------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 53   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
head \
-8 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 54   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"

First 8 lines of input FASTQ file: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq
-------------------------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 55   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
head \
-8 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 56   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"

Last 8 lines of input FASTQ file: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq
-------------------------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 57   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
tail \
-8 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 58   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"

Last 8 lines of input FASTQ file: /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq
-------------------------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 59   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
tail \
-8 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 60   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
overlap.py \
--input_1 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq \
--input_2 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq \
--processes 64 \
--fail-gracefully  \
--output /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_overlaps__0.txt \
2> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_overlaps_error__0.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 61   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
|==> SKIPPED workflow's IF because of the step count (value returned in the previous run is used).
Result of IF = FALSE [Unique Id = #DIFFERENT_SIZES_OF_READS_OVERLAP_0#]
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 62   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 63   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Erasing '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_overlaps__0.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 64   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Erasing '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_overlaps_error__0.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 65   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
remove_adapter.py \
--processes 64 \
--input_1 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-0_MDB.RI.T40_R1.fastq \
--input_2 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-1_MDB.RI.T40_R2.fastq \
--output_1 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-noadapt-0_MDB.RI.T40_R1.fastq \
--output_2 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-noadapt-1_MDB.RI.T40_R2.fastq \
--link hard \
> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_adapters_0.txt \
2>&1 
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 66   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 67   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Erasing '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_adapters_0.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 68   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
remove-bad-illumina.py \
--input /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-noadapt-0_MDB.RI.T40_R1.fastq \
--output /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-clear-noadapt-0_MDB.RI.T40_R1.fastq \
--link hard \
2> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_bad_illumina_1_0.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 69   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 70   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Erasing '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_bad_illumina_1_0.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 71   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
remove-bad-illumina.py \
--input /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-noadapt-1_MDB.RI.T40_R2.fastq \
--output /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-clear-noadapt-1_MDB.RI.T40_R2.fastq \
--link hard \
2> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_bad_illumina_2_0.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 72   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 73   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Erasing '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_bad_illumina_2_0.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 74   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
sra2illumina.py \
--input_1 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-clear-noadapt-0_MDB.RI.T40_R1.fastq \
--input_2 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-clear-noadapt-1_MDB.RI.T40_R2.fastq \
--output_1 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq \
--output_2 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-sra-clear-noadapt-1_MDB.RI.T40_R2.fastq \
--link hard \
--tmp_dir /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/tmp/
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 75   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
seqtk \
mergepe  \
 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq \
 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-sra-clear-noadapt-1_MDB.RI.T40_R2.fastq \
> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-shuffle-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 76   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"

"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 77   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
Total Count of reads (from all FASTQ files given as input and before any read removal is done, i.e. quality filtering, pre-processing):
--------------
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 78   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-shuffle-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq = "  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 79   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
cat \
 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-shuffle-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq \
|  \
echo $((`wc -l`/4))  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 80   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
solexa18to15.py \
--fail  \
--input /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-shuffle-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq \
--output /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-head-shuffle-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq \
--link hard
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 81   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
phred.py \
--link hard \
--input /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-head-shuffle-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq \
--output /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-phred-head-shuffle-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq \
--input_type auto-detect \
--output_type illumina-1.5 \
--tmp_dir /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/tmp/
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 82   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"

"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 83   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Skipping the moving from:
'/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/init-phred-head-shuffle-sra-clear-noadapt-0_MDB.RI.T40_R1.fastq'
to:
'/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/origin.fq'
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 84   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
lengths_reads.py \
--input /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/origin.fq \
--output /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_lengths_original_reads.txt \
--counts /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_counts_original_reads.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 85   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
compress-reads-ids.py \
--input /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/origin.fq \
--output /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/original.fq \
--count-reads /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_counts_original_reads.txt \
--lowercase 
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 86   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 87   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Skipping from erasing '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_lengths_original_reads.txt' (size: 246 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 88   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 89   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Erasing '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_counts_original_reads.txt' (size: 0 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 90   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Skipping the soft linking from:
'/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/original.fq'
to:
'/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/original-t5-t3.fq'
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 91   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Skipping the moving from:
'/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/original-t5-t3.fq'
to:
'/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads.fq'
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 92   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
lengths_reads.py \
--input /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads.fq \
--output /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_lengths_reads.txt
--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 93   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 94   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
|==> SKIPPED because of the step count.
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 95   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Skipping from erasing '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_lengths_reads.txt' (size: 246 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 96   Time: 21:15   Date: 2015-08-12 (elapsed time: 0d:0h:1m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
fastq_b2n.py \
--input /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads.fq \
--replacement A \
--ambiguous  \
--threshold 100 \
--output - \
|  \
trim_poly_tails.py  \
--input - \
--repeats 20 \
--output - \
2>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt \
|  \
seqtk  \
seq  \
-L 100 \
-  \
> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads_no-shorts.fq
--------------------------------------------------------------------------------
+-->EXECUTING...
==> Erasing file: '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads.fq' (size: 28551728260 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 44 minute(s), and 34 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 97   Time: 22:00   Date: 2015-08-12 (elapsed time: 0d:0h:45m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
pigz \
-p 64 \
-c /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/original.fq \
> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/original.fq.gz
--------------------------------------------------------------------------------
+-->EXECUTING...
==> Erasing file: '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/original.fq' (size: 28551728260 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 3 minute(s), and 4 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 98   Time: 22:03   Date: 2015-08-12 (elapsed time: 0d:0h:48m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
seqtk \
dropse  \
 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads_no-shorts.fq \
> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads_acgt.fq
--------------------------------------------------------------------------------
+-->EXECUTING...
==> Erasing file: '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads_no-shorts.fq' (size: 25379345328 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 5 minute(s), and 9 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 99   Time: 22:08   Date: 2015-08-12 (elapsed time: 0d:0h:53m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
cat \
 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads_acgt.fq \
|  \
echo $((`wc -l`/4))  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_removed_single_reads1.txt
--------------------------------------------------------------------------------
+-->EXECUTING...
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 2 minute(s), and 14 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 100   Time: 22:10   Date: 2015-08-12 (elapsed time: 0d:0h:56m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
+-->MOCK EXECUTION (i.e. code executed outside of workflow)...
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
APPENDING to file: '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt'.
>Count of all short reads after removing reads due to missing their mate read:
>-----------------------------------------------------------------------------
>from file: '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_removed_single_reads1.txt'
>
>
>
////////////////////////////////////////////////////////////////////////////////
  Running: step = 101   Time: 22:10   Date: 2015-08-12 (elapsed time: 0d:0h:56m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
Skipping from erasing '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_removed_single_reads1.txt' (size: 10 bytes)
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 102   Time: 22:10   Date: 2015-08-12 (elapsed time: 0d:0h:56m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
+-->EXECUTING workflow's IF...
Result of IF = FALSE [Unique Id = #READS_ACGT.FQ#]
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 103   Time: 22:10   Date: 2015-08-12 (elapsed time: 0d:0h:56m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'

--------------------------------------------------------------------------------
+-->MOCK EXECUTION (i.e. code executed outside of workflow)...
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 104   Time: 22:10   Date: 2015-08-12 (elapsed time: 0d:0h:56m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"
============
MEMORY (before using BOWTIE):
============
"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
+-->EXECUTING...
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 105   Time: 22:10   Date: 2015-08-12 (elapsed time: 0d:0h:56m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
free \
-m  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
+-->EXECUTING...
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 106   Time: 22:10   Date: 2015-08-12 (elapsed time: 0d:0h:56m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
printf \
"

"  \
>> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/info.txt
--------------------------------------------------------------------------------
+-->EXECUTING...
--------------------------------------------------------------------------------
==> Execution time: 0 day(s), 0 hour(s), 0 minute(s), and 0 second(s)
////////////////////////////////////////////////////////////////////////////////
  Running: step = 107   Time: 22:10   Date: 2015-08-12 (elapsed time: 0d:0h:56m)
\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
==> Current working directory: '/MGMSTAR1/SHARED/STAFF/KIRAN.P/fusioncatcher'
bowtie \
-t  \
-v 2 \
-p 64 \
-k 1 \
--solexa1.3-quals  \
--tryhard  \
--chunkmbs 128 \
--un /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads-filtered_temp.fq \
--max /dev/null \
 /data/current/rtrna_mt_index/ \
 /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads_acgt.fq \
 /dev/null \
2> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_bowtie_reads-filtered-out.stdout.txt
--------------------------------------------------------------------------------
+-->EXECUTING...

ERROR: Workflow execution failed at step 107 while executing:
----------------
   bowtie \
   -t  \
   -v 2 \
   -p 64 \
   -k 1 \
   --solexa1.3-quals  \
   --tryhard  \
   --chunkmbs 128 \
   --un /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads-filtered_temp.fq \
   --max /dev/null \
    /data/current/rtrna_mt_index/ \
    /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads_acgt.fq \
    /dev/null \
   2> /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_bowtie_reads-filtered-out.stdout.txt
----------------
  * Size '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads-filtered_temp.fq' = 0 bytes
  * Size '/data/current/rtrna_mt_index/' = 0 bytes
  * Size '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads_acgt.fq' = 23996689056 bytes
  * Size '/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/log_bowtie_reads-filtered-out.stdout.txt' = 418 bytes
Could not locate a Bowtie index corresponding to basename "/data/current/rtrna_mt_index/"
Overall time: 00:00:00
Command: bowtie --wrapper basic-0 -t -v 2 -p 64 -k 1 --solexa1.3-quals --tryhard --chunkmbs 128 --un /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads-filtered_temp.fq --max /dev/null /data/current/rtrna_mt_index/ /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB.RI.T40/reads_acgt.fq /dev/null 
################################################################################
################################################################################
TOTAL RUNNING TIME: 0 day(s), 0 hour(s), 55 minute(s), and 5 second(s) 
################################################################################
################################################################################

I could run the fusion with the same data build with empty rtrna_mt_index

Thank you looking forward for solution, i have 20 Cancer samples to Run.

Thank you

[ndaniel]

Hello!

It looks like the installation of FusionCatcher might be broken. For example, the path /data/current is very weird and by default FusionCatcher's installation script does not create something like this. Therefore it might be that it has been created manually copying it from somewhere else. By default the ......./fusioncatcher/data/current/rtrna_mt_index/ should contain the files

.1.ebwt
.2.ebwt
.3.ebwt
.4.ebwt
.rev.1.ebwt
.rev.2.ebwt

which are not visible in many cases (e.g. ls).

Please, could you run this command in a terminal and let me know what it reports?

ls -al /data/current/rtrna_mt_index/

[ndaniel]

Shortly, here FusionCatcher was launched something like this:

fusioncatcher.py \ 
--visualization-sam \ 
--5keep 0 \ 
-d /data/current \ 
-i /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB_RI_T19_R1.fastq.gz,/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB_RI_T19_R2.fastq.gz \ 
-o /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19

The first issue is that --5keep 0 should not be used unless there is a very good reason for it. That means that first run FusionCatcher using the default parameters (and default is --5keep 60) and if that gives bad results then one may consider playing with --5keep. Therefore, please, always use the default parameters of FusionCatcher for first run!

The second issue is that the path for -d is not specified correctly! It should not be used/specified here. FusionCatcher will be able to figure out itself the correct path for -d (for human genomes only) if it has been installed correctly. The -d should be specified/used only in cases where one looks for fusion genes in non-human organisms.

Therefore the solution here is to run FusionCatcher as following:

fusioncatcher.py \ 
--visualization-sam \ 
-i /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB_RI_T19_R1.fastq.gz,/MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Tobe_shipped/Transcriptome_PairedEnd/RAW_FASTQ/MDB_RI_T19_R2.fastq.gz \ 
-o /MGMSTAR1/SHARED/ANALYSIS/NGS_P1216/Fusions/MDB_RI_T19

and this was confirmed that it works!