search

ndierckx / NOVOPlasty

NOVOPlasty - The organelle assembler and heteroplasmy caller
Other
177 stars 63 forks source link

Any chance to proceed very short reads? #128

Closed OmonkeyGOD closed 4 years ago

OmonkeyGOD commented 4 years ago

Hi, I am trying to use NOVOPlasty to assemble a fungal mitogenome. However, I got this error: Unable to read any data from the read files. Check your files and maybe try to move the files to the same directory as the Perl file Inappropriate ioctl for device. I set k-mer as 23 and provided a reference genome sequence. The reads in fastq file are very short, around 36. Is this the reason for the error? @ERR062316.1 HWI-EAS422_30GRKAAXX_2_1_409_1525 GGAGTAGATATTATATTCTGTAGGGTGTTTTGCTCT +ERR062316.1 HWI-EAS422_30GRKAAXX_2_1_409_1525

<>><><>>>>8>>3<<73;<<<%0<+< @ERR062316.2 HWI-EAS422_30GRKAAXX_2_1_785_608 GGAACAACCTGCTGCACCTGACCAACATGCCCGTGA +ERR062316.2 HWI-EAS422_30GRKAAXX_2_1_785_608 88<<<<<<<<<<<<<<<<83<<<<<+<<8<3<<<8: @ERR062316.3 HWI-EAS422_30GRKAAXX_2_1_247_1437 GTAGAGGATGGGGACTGGGAAGAATGTGGCTGACAT

ndierckx commented 4 years ago

Hi,

Yeah I think 36 p is too short, I think lower limit is around 50 bp

OmonkeyGOD commented 4 years ago

Thank you for your reply.