Open bioramg opened 3 years ago
Hi,
That must be a bug, could you run it again with extended log to 1 and send me that file. Once the assembly got stuck or the log file is growing very big, you can terminate the assembly
Thank you. Please find the log extended log file. Also, I tried with kmer 41. Still having the issue. log_extended_plant_mt.txt
I doesn't show where it gets stuck, after how much time was this? Can you share your data with me?
Hi,
I am trying to assemble three plant mitochondrial genome sequences using Novoplasty. I successfully assembled two mitochondrial genomes. But When I try to assemble the third genome sequence using seed sequence as the input and raw and trimmed reads, the assembly to be freezing at a certain point and never run to complete. I have been waiting for one week and getting the same results when I try again. So, I subsample into 50% of raw reads and tried, I am getting the same issue. Could you please help me sort out this issue?
NOVOPlasty: The Organelle Assembler Version 4.2 Author: Nicolas Dierckxsens, (c) 2015-2020
Input parameters from the configuration file: Verify if everything is correct Project:
Project name = plant_mt Type = mito_plant Genome Range = 700000-800000 K-mer = 45 Max memory = Extended log = 0 Save assembled reads = yes Seed Input = /home//Unic_mapping/assembly.fasta Extend seed directly = no Reference sequence = Variance detection = Chloroplast sequence = /home/ref_cp_genome.fasta Dataset 1:
Read Length = 151 Insert size = 300 Platform = illumina Single/Paired = PE Combined reads = Forward reads = /home/subsample_50/forward_sub_50.fastq Reverse reads = /home/subsample_50/reverse_sub_50.fastq
Heteroplasmy:
MAF = HP exclude list = PCR-free = Optional:
Insert size auto = yes Use Quality Scores = no
Reading Input......OK
Scan chloroplast sequence......OK Subsampled fraction: 100.00 %
Retrieve Seed......OK
Initial read retrieved successfully: TTGCTTAGCTTGCCTTTCGCTTTATGATACCGATCCATTGGCCTAGCAAGTAGCTATGAGCCTGGCTGCCTTCCTCTCCTCCTTGCTACCCGAGAATGAAAGAAGAATGGAATGAGGGATCGTAGCAGCTCTTGGAGAAATTCCATTAGTA
Start Assembly...
1136868 bp assembled
Thank you.
With warm regards, Raman. G