search

ndierckx / NOVOPlasty

NOVOPlasty - The organelle assembler and heteroplasmy caller
Other
174 stars 63 forks source link

Assembly freezes #162

Open bioramg opened 3 years ago

bioramg commented 3 years ago

Hi,

I am trying to assemble three plant mitochondrial genome sequences using Novoplasty. I successfully assembled two mitochondrial genomes. But When I try to assemble the third genome sequence using seed sequence as the input and raw and trimmed reads, the assembly to be freezing at a certain point and never run to complete. I have been waiting for one week and getting the same results when I try again. So, I subsample into 50% of raw reads and tried, I am getting the same issue. Could you please help me sort out this issue?

NOVOPlasty: The Organelle Assembler Version 4.2 Author: Nicolas Dierckxsens, (c) 2015-2020

Input parameters from the configuration file: Verify if everything is correct Project:

Project name = plant_mt Type = mito_plant Genome Range = 700000-800000 K-mer = 45 Max memory = Extended log = 0 Save assembled reads = yes Seed Input = /home//Unic_mapping/assembly.fasta Extend seed directly = no Reference sequence = Variance detection = Chloroplast sequence = /home/ref_cp_genome.fasta Dataset 1:

Read Length = 151 Insert size = 300 Platform = illumina Single/Paired = PE Combined reads = Forward reads = /home/subsample_50/forward_sub_50.fastq Reverse reads = /home/subsample_50/reverse_sub_50.fastq

Heteroplasmy:

MAF = HP exclude list = PCR-free = Optional:

Insert size auto = yes Use Quality Scores = no

Reading Input......OK

Scan chloroplast sequence......OK Subsampled fraction: 100.00 %

Retrieve Seed......OK

Initial read retrieved successfully: TTGCTTAGCTTGCCTTTCGCTTTATGATACCGATCCATTGGCCTAGCAAGTAGCTATGAGCCTGGCTGCCTTCCTCTCCTCCTTGCTACCCGAGAATGAAAGAAGAATGGAATGAGGGATCGTAGCAGCTCTTGGAGAAATTCCATTAGTA

Start Assembly...

1136868 bp assembled

Thank you.

With warm regards, Raman. G

ndierckx commented 3 years ago

Hi,

That must be a bug, could you run it again with extended log to 1 and send me that file. Once the assembly got stuck or the log file is growing very big, you can terminate the assembly

bioramg commented 3 years ago

Thank you. Please find the log extended log file. Also, I tried with kmer 41. Still having the issue. log_extended_plant_mt.txt

ndierckx commented 3 years ago

I doesn't show where it gets stuck, after how much time was this? Can you share your data with me?