search

neufeld / pandaseq

PAired-eND Assembler for DNA sequences
GNU General Public License v3.0
129 stars 24 forks source link

BADID Issue #58

Closed SilentGene closed 7 years ago

SilentGene commented 7 years ago

Hi, I'v encountered a BADID issue when deal with my data: The command I used like this: $ pandaseq -6 -f 1.fq -r 2.fq -T 4 -w out.fa and I got an error message:

ERR BADID FCC5WLUACXX:::6:1101:1444:1965:TAATGTTG FCC5WLUACXX:6:1101:1444:1965#TAATGTTG/1 Something is wrong with this ID. If tags are absent, try passing the -B option. Consult pandaseq-checkid "FCC5WLUACXX:6:1101:1444:1965#TAATGTTG/1" to get an idea of the problem..

Then I run the pandaseq-checkid command, and I got:

FCC5WLUACXX:6:1101:1444:1965#TAATGTTG/1 ^ BAD instrument = "FCC5WLUACXX" run = "" flowcell = "" lane = 6 tile = 1101 x = 1444 y = 1965 tag = "TAATGTTG" generator = CASAVA 1.4-1.6

My Fastq file looks like this:

@FCC5WLUACXX:6:1101:1444:1965#TAATGTTG/1 NTAACAGCCCTTTTTTTTCAGCTTCTGTGTGTCCCCATCCTTCTTTTAGGTCAACGCCAAGTTCTCGGTGCAAATCATTCATCTTTTTTATAGAATCATG + BS\ceeeegggggiiiiiihhhiiiiigighhhiiihiiiiiihiiifhicghihiggeec`bddcccaacccccccccdcddcccccacccbbcccccc

I totally have no idea what can I do next, as I've already add -6 option in the command line. help.

apmasell commented 7 years ago

This is working for me. What version of PANDAseq are you using?

SilentGene commented 7 years ago

pandaseq 2.10 May because the version I used is too old? I think maybe I should update the software.

apmasell commented 7 years ago

These look like the converted headers. Support was added in 2c738d29bc1ce05a1ec3d6fc82125f4eb516ea81, but I have not released a version with this support. If you want to use it, you'll have to compile from source.

On 21 November 2016 at 09:18, Heyu Lin notifications@github.com wrote:

pandaseq 2.10 May because the version I used is too old? I think maybe I should update the software.

— You are receiving this because you commented. Reply to this email directly, view it on GitHub https://github.com/neufeld/pandaseq/issues/58#issuecomment-261949897, or mute the thread https://github.com/notifications/unsubscribe-auth/AAQoJ6PONq9FD5K2wZCGQZaUmpda_xFhks5rAahGgaJpZM4K4Jdg .

--Andre Masellaandre@masella.name http://www.masella.name/

SilentGene commented 7 years ago

OK, I'll try and see if the update works. Thank you!

SilentGene commented 7 years ago

Hi, I updated the program to the most rencent version, and it works! Thanks a lot :)