Closed j23414 closed 2 months ago
ViPR is being replaced with BV-BRC with final transfer possibly occurring by the end of the year (2022-12-31) which might disrupt pathogen builds.
For any pathogen builds depending on ViPR (such as zika), we should make sure we can do one (or a combination) of the following:
GenomicFastaResults.fasta
So far the user interface seems pretty equivalent:
However we may need to modify the fasta headers:
Notice how the header field is different from ViPR and not modifiable like ViPR. (example from dengue)
head BVBRC_genome_sequence.fasta >accn|KY829115 Dengue virus 1 isolate H.sapiens-wt/BLM/2016/MA-WGS16-006-SER, complete genome. [Dengue virus 1 H.sapiens-wt/BLM/2016/MA-WGS16-006-SER strain Dengue virus 1/H.sapiens-wt/BLM/2016/MA-WGS16-006-SER | 11053.9479] agttgttagtctacgtggaccgacaagaacagtttcgaatcggaagcttgcttaacgtag ttctaacagttttttattagagagcagatctctgatgaacaaccaacggaaaaagacggg tcgaccgtctttcaatatgctgaaacgcgcgagaaaccgcgtgtcaactggttcacagtt
Instead we may need to download and process the tabular data to match our current GenomicFastaResults.fasta headers:
example from Zika
less GenomicFastaResults.fasta >KY241742|ZIKV_SG_072|NA|2016_08_28|Human|Singapore|Asian|Zika_virus GAATCAGACTGCGACAGTTCGAGTTTGAAGCGAAAGCTAGCAACAGTATCAACAGGTTTTATTTTGGATT TGGAAACGAGAGTTTCTGGTCATGAAAAACCCAAAAAAGAAATCCGGAGGATTCCGGATTGTCAATATGC TAAAACGCGGAGTAGCCCGTGTGAGCCCCTTTGGGGGCTTGAAGAGGCTGCCAGCCGGACTTCTGCTGGG TCATGGGCCCATCAGGATGGTCTTGGCGATTCTAGCCTTTTTGAGGTTCACGGCAATCAAGCCATCACTG
Alternatively, someone could do a deep dive into BV-BRC cli
Just a note that ViPR website redirects to BV-BRC. Ergo any ViPR instructions may be out of date
Closing this, since instead of adding BV-BRC support, we've gone in the direction of using Entrez or NCBI datasets in the pathogen repo-guide.
Context
ViPR is being replaced with BV-BRC with final transfer possibly occurring by the end of the year (2022-12-31) which might disrupt pathogen builds.
Description
For any pathogen builds depending on ViPR (such as zika), we should make sure we can do one (or a combination) of the following:
GenomicFastaResults.fasta
Possible solution
So far the user interface seems pretty equivalent:
However we may need to modify the fasta headers:
Notice how the header field is different from ViPR and not modifiable like ViPR. (example from dengue)
Instead we may need to download and process the tabular data to match our current
GenomicFastaResults.fasta
headers:example from Zika
Alternatively, someone could do a deep dive into BV-BRC cli