search

nf-core / ampliseq

Amplicon sequencing analysis workflow using DADA2 and QIIME2
https://nf-co.re/ampliseq
MIT License
182 stars 115 forks source link

Error in command #623

Closed dixi06 closed 1 year ago

dixi06 commented 1 year ago

Hi I am new to nextflow, I was trying to run the pipeline but it gives me errors. Can you please let me know wheat is wrong with my command.

nextflow run nf-core/ampliseq \ -profile singularity \ --input "~/Biovigilance_2021/ITS/" --FW_primer AHCGATGAAGAACRYAG \ --RV_primer CTTATTGATATGCTTAAGTTCAG \ --outdir “~/ITS_2021/”

ERROR ~ ERROR: Validation of pipeline parameters failed!

-- Check '.nextflow.log' file for details ERROR ~ * Missing required parameter: --outdir

-- Check '.nextflow.log' file for details

Exiting! -bash: --FW_primer: command not found

Thanks.

a4000 commented 1 year ago

It looks like your command is on multiple lines. You can put everything on one line or try adding '\\' at the end of every line except for the last line. E.g.,

nextflow run nf-core/ampliseq \ -profile singularity \ --input "/Biovigilance_2021/ITS/" \ --FW_primer AHCGATGAAGAACRYAG \ --RV_primer CTTATTGATATGCTTAAGTTCAG \ --outdir “/ITS_2021/”

d4straub commented 1 year ago

Or you just write all in one line, e.g. nextflow run nf-core/ampliseq -profile singularity --input "/Biovigilance_2021/ITS/" --FW_primer AHCGATGAAGAACRYAG --RV_primer CTTATTGATATGCTTAAGTTCAG --outdir “/ITS_2021/” I close that here, but please feel free to open another issue. For beginner questions it might be also helpful to have a look at the nf-core slack channel #ampliseq.