nf-core / ampliseq

Amplicon sequencing analysis workflow using DADA2 and QIIME2
https://nf-co.re/ampliseq
MIT License
188 stars 119 forks source link

Abundance plots for qiime2 results without metadata provided #738

Closed SergeWielhouwer closed 5 months ago

SergeWielhouwer commented 6 months ago

Description of feature

Hi,

Thanks for developing Ampliseq!

I was wondering whether a metadata file is really necessary for the visualisation of the relative microbial abundance per sample. Currently, QIIME2 barplots (HTML) are available in addition to the different level tsv tables when providing such files, but when running without this file no visualisations are available for the taxonomic classification part. These plots really help to get a quick overview of the different compositions of all samples without any data wrangling. Are there any plans to add such visualisations (Krona, QIIME2) to the output when no differential abundance analysis (i.e. no metadata file given) is performed?

I am currently using matplotlib on the relative qiime2 tables as an alternative, but would love to see some (interactive) plots readily available from the pipeline output :). I am currently on version v2.9.0.

/mnt/shared/tools/nextflow-23.10.1/nextflow run /mnt/shared/development/16Smicrobiome/ampliseq-2.9.0/main.nf -profile singularity --input samplesheet.tsv --FW_primer "TATGGTAATTGTGTGCCAGCMGCCGCGGTA" --RV_primer "GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC" --retain_untrimmed --outdir output -resume

Best regards,

Serge

d4straub commented 6 months ago

I think metdata is not required by the function that produces barplots. However, the pipeline requires it, thats a relict of the past when metadata was indeed necessary for producing barplots. Thats a good point and should be fixed for the next release.

For now, you could give it a metadata file with one "fake" category so that the barplot is produced (and skip whatever you do not like via parameters).

SergeWielhouwer commented 6 months ago

That would be great, Thanks!

d4straub commented 5 months ago

This is in the dev branch and will be in the next release.