nf-core / mag

Assembly and binning of metagenomes
https://nf-co.re/mag
MIT License
192 stars 102 forks source link

Temporary test full profile (until container and tax anno reference files fixed) #575

Closed jfy133 closed 5 months ago

jfy133 commented 5 months ago

Context:

Former we need to try different container possibly, latter we apparently need to minimise the amount of file moving operations (or something along those lines... Both Jordi and Adam have looked into these at various points)

So deactivating all of the above for now

PR checklist

github-actions[bot] commented 5 months ago

nf-core lint overall result: Passed :white_check_mark: :warning:

Posted for pipeline commit 818b9b4

+| ✅ 211 tests passed       |+
#| ❔   3 tests were ignored |#
!| ❗   4 tests had warnings |!
### :heavy_exclamation_mark: Test warnings: * [pipeline_todos](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/pipeline_todos.html) - TODO string in `main.nf`: _Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]_ * [pipeline_todos](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/pipeline_todos.html) - TODO string in `methods_description_template.yml`: _#Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline_ * [pipeline_todos](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/pipeline_todos.html) - TODO string in `WorkflowMag.groovy`: _Optionally add in-text citation tools to this list._ * [schema_lint](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/schema_lint.html) - Input mimetype is missing or empty ### :grey_question: Tests ignored: * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default ignored: params.phix_reference * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default ignored: params.lambda_reference * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - File ignored due to lint config: `lib/NfcoreTemplate.groovy` ### :white_check_mark: Tests passed: * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.gitattributes` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.gitignore` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.nf-core.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.editorconfig` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.prettierignore` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.prettierrc.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `CHANGELOG.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `CITATIONS.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `CODE_OF_CONDUCT.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `LICENSE` or `LICENSE.md` or `LICENCE` or `LICENCE.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `nextflow_schema.json` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `nextflow.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `README.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/.dockstore.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/CONTRIBUTING.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/ISSUE_TEMPLATE/bug_report.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/ISSUE_TEMPLATE/config.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/ISSUE_TEMPLATE/feature_request.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/PULL_REQUEST_TEMPLATE.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/branch.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/ci.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/linting_comment.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/linting.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `assets/email_template.html` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `assets/email_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `assets/sendmail_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `assets/nf-core-mag_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `conf/modules.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `conf/test.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `conf/test_full.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/images/nf-core-mag_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/images/nf-core-mag_logo_dark.png` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/output.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/usage.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `lib/NfcoreTemplate.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `lib/Utils.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `lib/WorkflowMain.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `main.nf` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `assets/multiqc_config.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `conf/base.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `conf/igenomes.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/awstest.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/awsfulltest.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `lib/WorkflowMag.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `modules.json` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `pyproject.toml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `Singularity` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `parameters.settings.json` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `pipeline_template.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.nf-core.yaml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `bin/markdown_to_html.r` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `conf/aws.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.github/workflows/push_dockerhub.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.github/ISSUE_TEMPLATE/bug_report.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.github/ISSUE_TEMPLATE/feature_request.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `docs/images/nf-core-mag_logo.png` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.markdownlint.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.yamllint.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `lib/Checks.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `lib/Completion.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `lib/Workflow.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `lib/nfcore_external_java_deps.jar` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.travis.yml` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.name` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.nextflowVersion` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.description` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.version` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.homePage` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `timeline.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `trace.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `report.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `dag.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `process.cpus` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `process.memory` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `process.time` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `params.outdir` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `params.input` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `params.validationShowHiddenParams` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `params.validationSchemaIgnoreParams` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.mainScript` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `timeline.file` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `trace.file` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `report.file` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `dag.file` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.nf_required_version` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.container` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.singleEnd` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.igenomesIgnore` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.name` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.enable_conda` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``timeline.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``report.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``trace.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``dag.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``manifest.name`` began with ``nf-core/`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable ``manifest.homePage`` began with https://github.com/nf-core/ * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``dag.file`` ended with ``.html`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable ``manifest.nextflowVersion`` started with >= or !>= * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``manifest.version`` ends in ``dev``: ``2.5.3dev`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config `params.custom_config_version` is set to `master` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config `params.custom_config_base` is set to `https://raw.githubusercontent.com/nf-core/configs/master` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Lines for loading custom profiles found * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - nextflow.config contains configuration profile `test` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/ * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.custom_config_version= master * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.max_cpus= 16 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.max_memory= 128.GB * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.max_time= 240.h * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.publish_dir_mode= copy * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.max_multiqc_email_size= 25.MB * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.validate_params= true * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.spades_fix_cpus= -1 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.spadeshybrid_fix_cpus= -1 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.metabat_rng_seed= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.clip_tool= fastp * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.reads_minlength= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.fastp_qualified_quality= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.fastp_cut_mean_quality= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.adapterremoval_minquality= 2 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bbnorm_target= 100 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bbnorm_min= 5 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.longreads_min_length= 1000 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.longreads_keep_percent= 90 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.longreads_length_weight= 10 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_min_completeness= 50.0 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_max_contamination= 10.0 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_min_perc_aa= 10.0 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_min_af= 0.65 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_pplacer_scratch= true * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.genomad_min_score= 0.7 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.genomad_splits= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.binning_map_mode= group * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.min_contig_size= 1500 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.min_length_unbinned_contigs= 1000000 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.max_unbinned_contigs= 100 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bin_domain_classification_tool= tiara * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.tiara_min_length= 3000 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.binqc_tool= busco * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.refine_bins_dastool_threshold= 0.5 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.postbinning_input= raw_bins_only * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gunc_database_type= progenomes * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.pydamage_accuracy= 0.5 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.freebayes_ploidy= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.freebayes_min_basequality= 20 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.freebayes_minallelefreq= 0.33 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bcftools_view_high_variant_quality= 30 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bcftools_view_medium_variant_quality= 20 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bcftools_view_minimal_allelesupport= 3 * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.gitattributes` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.prettierrc.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `CODE_OF_CONDUCT.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `LICENSE` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/.dockstore.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/CONTRIBUTING.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/ISSUE_TEMPLATE/bug_report.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/ISSUE_TEMPLATE/config.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/ISSUE_TEMPLATE/feature_request.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/PULL_REQUEST_TEMPLATE.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/workflows/branch.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/workflows/linting_comment.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/workflows/linting.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `assets/email_template.html` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `assets/email_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `assets/sendmail_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `assets/nf-core-mag_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `docs/images/nf-core-mag_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `docs/images/nf-core-mag_logo_dark.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `docs/README.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.gitignore` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.prettierignore` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `pyproject.toml` matches the template * [actions_ci](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_ci.html) - '.github/workflows/ci.yml' is triggered on expected events * [actions_ci](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_ci.html) - '.github/workflows/ci.yml' checks minimum NF version * [actions_awstest](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_awstest.html) - '.github/workflows/awstest.yml' is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_awsfulltest.html) - `.github/workflows/awsfulltest.yml` is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_awsfulltest.html) - `.github/workflows/awsfulltest.yml` does not use `-profile test` * [readme](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/readme.html) - README Nextflow minimum version badge matched config. Badge: `23.04.0`, Config: `23.04.0` * [readme](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/readme.html) - README Zenodo placeholder was replaced with DOI. * [pipeline_name_conventions](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/pipeline_name_conventions.html) - Name adheres to nf-core convention * [template_strings](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/template_strings.html) - Did not find any Jinja template strings (239 files) * [schema_lint](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/schema_lint.html) - Schema lint passed * [schema_lint](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/schema_lint.html) - Schema title + description lint passed * [schema_params](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/schema_params.html) - Schema matched params returned from nextflow config * [system_exit](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/system_exit.html) - No `System.exit` calls found * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: release-announcements.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: download_pipeline.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: branch.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: fix-linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: awsfulltest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: ci.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: clean-up.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: linting_comment.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: awstest.yml * [merge_markers](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/merge_markers.html) - No merge markers found in pipeline files * [modules_json](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/modules_json.html) - Only installed modules found in `modules.json` * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' contains `report_section_order` * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' contains `export_plots` * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' contains `report_comment` * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' follows the ordering scheme of the minimally required plugins. * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' contains a matching 'report_comment'. * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' contains 'export_plots: true'. * [modules_structure](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/modules_structure.html) - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL' ### Run details * nf-core/tools version 2.12.1 * Run at `2024-02-05 07:44:09`