nf-core / mag

Assembly and binning of metagenomes
https://nf-co.re/mag
MIT License
209 stars 107 forks source link

Add custom script licences to all tools #581

Closed jfy133 closed 7 months ago

jfy133 commented 7 months ago

Closes #570

PR checklist

github-actions[bot] commented 7 months ago

nf-core lint overall result: Passed :white_check_mark: :warning:

Posted for pipeline commit 7359174

+| ✅ 211 tests passed       |+
#| ❔   3 tests were ignored |#
!| ❗   4 tests had warnings |!
### :heavy_exclamation_mark: Test warnings: * [pipeline_todos](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/pipeline_todos.html) - TODO string in `main.nf`: _Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]_ * [pipeline_todos](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/pipeline_todos.html) - TODO string in `WorkflowMag.groovy`: _Optionally add in-text citation tools to this list._ * [pipeline_todos](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/pipeline_todos.html) - TODO string in `methods_description_template.yml`: _#Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline_ * [schema_lint](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/schema_lint.html) - Input mimetype is missing or empty ### :grey_question: Tests ignored: * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default ignored: params.phix_reference * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default ignored: params.lambda_reference * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - File ignored due to lint config: `lib/NfcoreTemplate.groovy` ### :white_check_mark: Tests passed: * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.gitattributes` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.gitignore` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.nf-core.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.editorconfig` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.prettierignore` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.prettierrc.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `CHANGELOG.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `CITATIONS.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `CODE_OF_CONDUCT.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `LICENSE` or `LICENSE.md` or `LICENCE` or `LICENCE.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `nextflow_schema.json` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `nextflow.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `README.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/.dockstore.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/CONTRIBUTING.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/ISSUE_TEMPLATE/bug_report.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/ISSUE_TEMPLATE/config.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/ISSUE_TEMPLATE/feature_request.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/PULL_REQUEST_TEMPLATE.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/branch.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/ci.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/linting_comment.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/linting.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `assets/email_template.html` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `assets/email_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `assets/sendmail_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `assets/nf-core-mag_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `conf/modules.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `conf/test.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `conf/test_full.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/images/nf-core-mag_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/images/nf-core-mag_logo_dark.png` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/output.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `docs/usage.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `lib/NfcoreTemplate.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `lib/Utils.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `lib/WorkflowMain.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `main.nf` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `assets/multiqc_config.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `conf/base.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `conf/igenomes.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/awstest.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `.github/workflows/awsfulltest.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `lib/WorkflowMag.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `modules.json` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File found: `pyproject.toml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `Singularity` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `parameters.settings.json` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `pipeline_template.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.nf-core.yaml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `bin/markdown_to_html.r` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `conf/aws.config` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.github/workflows/push_dockerhub.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.github/ISSUE_TEMPLATE/bug_report.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.github/ISSUE_TEMPLATE/feature_request.md` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `docs/images/nf-core-mag_logo.png` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.markdownlint.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.yamllint.yml` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `lib/Checks.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `lib/Completion.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `lib/Workflow.groovy` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `lib/nfcore_external_java_deps.jar` * [files_exist](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_exist.html) - File not found check: `.travis.yml` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.name` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.nextflowVersion` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.description` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.version` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.homePage` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `timeline.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `trace.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `report.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `dag.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `process.cpus` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `process.memory` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `process.time` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `params.outdir` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `params.input` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `params.validationShowHiddenParams` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `params.validationSchemaIgnoreParams` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `manifest.mainScript` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `timeline.file` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `trace.file` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `report.file` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable found: `dag.file` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.nf_required_version` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.container` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.singleEnd` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.igenomesIgnore` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.name` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable (correctly) not found: `params.enable_conda` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``timeline.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``report.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``trace.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``dag.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``manifest.name`` began with ``nf-core/`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable ``manifest.homePage`` began with https://github.com/nf-core/ * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``dag.file`` ended with ``.html`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config variable ``manifest.nextflowVersion`` started with >= or !>= * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config ``manifest.version`` ends in ``dev``: ``2.5.4dev`` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config `params.custom_config_version` is set to `master` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config `params.custom_config_base` is set to `https://raw.githubusercontent.com/nf-core/configs/master` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Lines for loading custom profiles found * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - nextflow.config contains configuration profile `test` * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/ * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.custom_config_version= master * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.max_cpus= 16 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.max_memory= 128.GB * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.max_time= 240.h * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.publish_dir_mode= copy * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.max_multiqc_email_size= 25.MB * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.validate_params= true * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.spades_fix_cpus= -1 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.spadeshybrid_fix_cpus= -1 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.metabat_rng_seed= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.clip_tool= fastp * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.reads_minlength= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.fastp_qualified_quality= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.fastp_cut_mean_quality= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.adapterremoval_minquality= 2 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bbnorm_target= 100 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bbnorm_min= 5 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.longreads_min_length= 1000 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.longreads_keep_percent= 90 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.longreads_length_weight= 10 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_min_completeness= 50.0 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_max_contamination= 10.0 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_min_perc_aa= 10.0 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_min_af= 0.65 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gtdbtk_pplacer_scratch= true * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.genomad_min_score= 0.7 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.genomad_splits= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.binning_map_mode= group * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.min_contig_size= 1500 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.min_length_unbinned_contigs= 1000000 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.max_unbinned_contigs= 100 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bin_domain_classification_tool= tiara * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.tiara_min_length= 3000 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.binqc_tool= busco * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.refine_bins_dastool_threshold= 0.5 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.postbinning_input= raw_bins_only * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.gunc_database_type= progenomes * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.pydamage_accuracy= 0.5 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.freebayes_ploidy= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.freebayes_min_basequality= 20 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.freebayes_minallelefreq= 0.33 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bcftools_view_high_variant_quality= 30 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bcftools_view_medium_variant_quality= 20 * [nextflow_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/nextflow_config.html) - Config default value correct: params.bcftools_view_minimal_allelesupport= 3 * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.gitattributes` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.prettierrc.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `CODE_OF_CONDUCT.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `LICENSE` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/.dockstore.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/CONTRIBUTING.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/ISSUE_TEMPLATE/bug_report.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/ISSUE_TEMPLATE/config.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/ISSUE_TEMPLATE/feature_request.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/PULL_REQUEST_TEMPLATE.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/workflows/branch.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/workflows/linting_comment.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.github/workflows/linting.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `assets/email_template.html` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `assets/email_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `assets/sendmail_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `assets/nf-core-mag_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `docs/images/nf-core-mag_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `docs/images/nf-core-mag_logo_dark.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `docs/README.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.gitignore` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `.prettierignore` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/files_unchanged.html) - `pyproject.toml` matches the template * [actions_ci](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_ci.html) - '.github/workflows/ci.yml' is triggered on expected events * [actions_ci](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_ci.html) - '.github/workflows/ci.yml' checks minimum NF version * [actions_awstest](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_awstest.html) - '.github/workflows/awstest.yml' is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_awsfulltest.html) - `.github/workflows/awsfulltest.yml` is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_awsfulltest.html) - `.github/workflows/awsfulltest.yml` does not use `-profile test` * [readme](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/readme.html) - README Nextflow minimum version badge matched config. Badge: `23.04.0`, Config: `23.04.0` * [readme](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/readme.html) - README Zenodo placeholder was replaced with DOI. * [pipeline_name_conventions](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/pipeline_name_conventions.html) - Name adheres to nf-core convention * [template_strings](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/template_strings.html) - Did not find any Jinja template strings (239 files) * [schema_lint](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/schema_lint.html) - Schema lint passed * [schema_lint](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/schema_lint.html) - Schema title + description lint passed * [schema_params](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/schema_params.html) - Schema matched params returned from nextflow config * [system_exit](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/system_exit.html) - No `System.exit` calls found * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: linting_comment.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: ci.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: release-announcements.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: clean-up.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: branch.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: download_pipeline.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: fix-linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: awstest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/actions_schema_validation.html) - Workflow validation passed: awsfulltest.yml * [merge_markers](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/merge_markers.html) - No merge markers found in pipeline files * [modules_json](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/modules_json.html) - Only installed modules found in `modules.json` * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' contains `report_section_order` * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' contains `export_plots` * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' contains `report_comment` * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' follows the ordering scheme of the minimally required plugins. * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' contains a matching 'report_comment'. * [multiqc_config](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/multiqc_config.html) - 'assets/multiqc_config.yml' contains 'export_plots: true'. * [modules_structure](https://nf-co.re/tools/docs/2.12.1/pipeline_lint_tests/modules_structure.html) - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL' ### Run details * nf-core/tools version 2.12.1 * Run at `2024-02-09 13:30:41`