github-actions[bot]
commented
3 months ago nf-core lint overall result: Failed :x:
Posted for pipeline commit 2f62ecd
+| ✅ 201 tests passed |+
#| ❔ 2 tests were ignored |#
!| ❗ 4 tests had warnings |!
-| ❌ 10 tests failed |-
### :x: Test failures:
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File must be removed: `lib/Utils.groovy`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File must be removed: `lib/WorkflowMain.groovy`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File must be removed: `lib/NfcoreTemplate.groovy`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File must be removed: `lib/WorkflowMag.groovy`
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.github/CONTRIBUTING.md` does not match the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.github/PULL_REQUEST_TEMPLATE.md` does not match the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/branch.yml` does not match the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting_comment.yml` does not match the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting.yml` does not match the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `pyproject.toml` does not match the template
### :heavy_exclamation_mark: Test warnings:
* [pipeline_todos](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]_
* [pipeline_todos](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/pipeline_todos) - TODO string in `WorkflowMag.groovy`: _Optionally add in-text citation tools to this list._
* [pipeline_todos](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/pipeline_todos) - TODO string in `methods_description_template.yml`: _#Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline_
* [schema_lint](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/schema_lint) - Input mimetype is missing or empty
### :grey_question: Tests ignored:
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default ignored: params.phix_reference
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default ignored: params.lambda_reference
### :white_check_mark: Tests passed:
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.gitattributes`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.gitignore`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.nf-core.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.editorconfig`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.prettierignore`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.prettierrc.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `CHANGELOG.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `CITATIONS.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `CODE_OF_CONDUCT.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `LICENSE` or `LICENSE.md` or `LICENCE` or `LICENCE.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `nextflow_schema.json`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `nextflow.config`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `README.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/.dockstore.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/CONTRIBUTING.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/bug_report.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/config.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/feature_request.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/PULL_REQUEST_TEMPLATE.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/branch.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/ci.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting_comment.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `assets/email_template.html`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `assets/email_template.txt`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `assets/sendmail_template.txt`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `assets/nf-core-mag_logo_light.png`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `conf/modules.config`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `conf/test.config`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `conf/test_full.config`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-mag_logo_light.png`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-mag_logo_dark.png`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `docs/output.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `docs/README.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `docs/README.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `docs/usage.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `main.nf`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `assets/multiqc_config.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `conf/base.config`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `conf/igenomes.config`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awstest.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awsfulltest.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `modules.json`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File found: `pyproject.toml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `Singularity`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `parameters.settings.json`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `pipeline_template.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `.nf-core.yaml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `bin/markdown_to_html.r`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `conf/aws.config`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `.github/workflows/push_dockerhub.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/bug_report.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/feature_request.md`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `docs/images/nf-core-mag_logo.png`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `.markdownlint.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `.yamllint.yml`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Checks.groovy`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Completion.groovy`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Workflow.groovy`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `lib/nfcore_external_java_deps.jar`
* [files_exist](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_exist) - File not found check: `.travis.yml`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.name`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.nextflowVersion`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.description`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.version`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.homePage`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.enabled`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.enabled`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `report.enabled`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.enabled`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.cpus`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.memory`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.time`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.outdir`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.input`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.validationShowHiddenParams`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.validationSchemaIgnoreParams`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.mainScript`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.file`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.file`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `report.file`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.file`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.nf_required_version`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.container`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.singleEnd`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.igenomesIgnore`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.name`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.enable_conda`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config ``timeline.enabled`` had correct value: ``true``
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config ``report.enabled`` had correct value: ``true``
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config ``trace.enabled`` had correct value: ``true``
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config ``dag.enabled`` had correct value: ``true``
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config ``manifest.name`` began with ``nf-core/``
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.homePage`` began with https://github.com/nf-core/
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config ``dag.file`` ended with ``.html``
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.nextflowVersion`` started with >= or !>=
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config ``manifest.version`` ends in ``dev``: ``2.5.5dev``
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_version` is set to `master`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_base` is set to `https://raw.githubusercontent.com/nf-core/configs/master`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Lines for loading custom profiles found
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - nextflow.config contains configuration profile `test`
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_version= master
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_cpus= 16
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_memory= 128.GB
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_time= 240.h
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.publish_dir_mode= copy
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_multiqc_email_size= 25.MB
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.validate_params= true
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.spades_fix_cpus= -1
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.spadeshybrid_fix_cpus= -1
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.metabat_rng_seed= 1
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.clip_tool= fastp
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.reads_minlength= 15
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_qualified_quality= 15
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_cut_mean_quality= 15
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.adapterremoval_minquality= 2
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bbnorm_target= 100
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bbnorm_min= 5
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.longreads_min_length= 1000
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.longreads_keep_percent= 90
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.longreads_length_weight= 10
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_min_completeness= 50.0
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_max_contamination= 10.0
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_min_af= 0.65
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_pplacer_scratch= true
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.genomad_min_score= 0.7
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.genomad_splits= 1
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.binning_map_mode= group
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.min_contig_size= 1500
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.min_length_unbinned_contigs= 1000000
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_unbinned_contigs= 100
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bin_domain_classification_tool= tiara
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.tiara_min_length= 3000
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.binqc_tool= busco
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.refine_bins_dastool_threshold= 0.5
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.postbinning_input= raw_bins_only
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gunc_database_type= progenomes
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.pydamage_accuracy= 0.5
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.freebayes_ploidy= 1
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.freebayes_min_basequality= 20
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.freebayes_minallelefreq= 0.33
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bcftools_view_high_variant_quality= 30
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bcftools_view_medium_variant_quality= 20
* [nextflow_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.gitattributes` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.prettierrc.yml` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `CODE_OF_CONDUCT.md` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `LICENSE` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.github/.dockstore.yml` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/bug_report.yml` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/config.yml` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/feature_request.yml` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `assets/email_template.html` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `assets/email_template.txt` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `assets/sendmail_template.txt` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `assets/nf-core-mag_logo_light.png` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-mag_logo_light.png` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-mag_logo_dark.png` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `docs/README.md` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.gitignore` matches the template
* [files_unchanged](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/files_unchanged) - `.prettierignore` matches the template
* [actions_ci](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' is triggered on expected events
* [actions_ci](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' checks minimum NF version
* [actions_awstest](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_awstest) - '.github/workflows/awstest.yml' is triggered correctly
* [actions_awsfulltest](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` is triggered correctly
* [actions_awsfulltest](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` does not use `-profile test`
* [readme](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/readme) - README Nextflow minimum version badge matched config. Badge: `23.04.0`, Config: `23.04.0`
* [readme](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/readme) - README Zenodo placeholder was replaced with DOI.
* [pipeline_name_conventions](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/pipeline_name_conventions) - Name adheres to nf-core convention
* [template_strings](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/template_strings) - Did not find any Jinja template strings (244 files)
* [schema_lint](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/schema_lint) - Schema lint passed
* [schema_lint](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/schema_lint) - Schema title + description lint passed
* [schema_params](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/schema_params) - Schema matched params returned from nextflow config
* [system_exit](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/system_exit) - No `System.exit` calls found
* [actions_schema_validation](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awstest.yml
* [actions_schema_validation](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: branch.yml
* [actions_schema_validation](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: ci.yml
* [actions_schema_validation](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: clean-up.yml
* [actions_schema_validation](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: fix-linting.yml
* [actions_schema_validation](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: release-announcements.yml
* [actions_schema_validation](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting.yml
* [actions_schema_validation](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awsfulltest.yml
* [actions_schema_validation](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting_comment.yml
* [actions_schema_validation](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: download_pipeline.yml
* [merge_markers](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/merge_markers) - No merge markers found in pipeline files
* [modules_json](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/modules_json) - Only installed modules found in `modules.json`
* [multiqc_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/multiqc_config) - 'assets/multiqc_config.yml' contains `report_section_order`
* [multiqc_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/multiqc_config) - 'assets/multiqc_config.yml' contains `export_plots`
* [multiqc_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/multiqc_config) - 'assets/multiqc_config.yml' contains `report_comment`
* [multiqc_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/multiqc_config) - 'assets/multiqc_config.yml' follows the ordering scheme of the minimally required plugins.
* [multiqc_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/multiqc_config) - 'assets/multiqc_config.yml' contains a matching 'report_comment'.
* [multiqc_config](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/multiqc_config) - 'assets/multiqc_config.yml' contains 'export_plots: true'.
* [modules_structure](https://nf-co.re/tools/docs/2.13.1/pipeline_lint_tests/modules_structure) - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
### Run details
* nf-core/tools version 2.13.1
* Run at `2024-04-18 09:45:35`
This PR enables the possibility to perform co-binning when using the ancient DNA mode.
Once merged, it can close #572
PR checklist
nextflow run . -profile test,docker --outdir <OUTDIR>).CHANGELOG.mdis updated.