nf-core / mag

Assembly and binning of metagenomes
https://nf-co.re/mag
MIT License
192 stars 102 forks source link

Patch release 3.0.2 for fixing BUSCO, CONCOCT and Docker container errors #635

Closed jfy133 closed 3 days ago

jfy133 commented 1 week ago

PR checklist

github-actions[bot] commented 1 week ago

nf-core lint overall result: Passed :white_check_mark: :warning:

Posted for pipeline commit 4e12465

+| ✅ 306 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗   6 tests had warnings |!
### :heavy_exclamation_mark: Test warnings: * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``manifest.version`` should end in ``dev``: ``3.0.2`` * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]_ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Optionally add in-text citation tools to this list._ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Optionally add bibliographic entries to this list._ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!_ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `methods_description_template.yml`: _#Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline_ ### :grey_question: Tests ignored: * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default ignored: params.phix_reference * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default ignored: params.lambda_reference ### :white_check_mark: Tests passed: * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.gitattributes` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.gitignore` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.nf-core.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.editorconfig` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.prettierignore` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.prettierrc.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CHANGELOG.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CITATIONS.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CODE_OF_CONDUCT.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `LICENSE` or `LICENSE.md` or `LICENCE` or `LICENCE.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `nextflow_schema.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `nextflow.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/.dockstore.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/CONTRIBUTING.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/bug_report.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/config.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/feature_request.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/PULL_REQUEST_TEMPLATE.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/branch.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/ci.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting_comment.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/email_template.html` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/email_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/sendmail_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/nf-core-mag_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/modules.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/test.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/test_full.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-mag_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-mag_logo_dark.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/output.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/usage.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `main.nf` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/multiqc_config.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/base.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/igenomes.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awstest.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awsfulltest.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `modules.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/bug_report.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/feature_request.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/workflows/push_dockerhub.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.markdownlint.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.nf-core.yaml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.yamllint.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `bin/markdown_to_html.r` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `conf/aws.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `docs/images/nf-core-mag_logo.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Checks.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Completion.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/NfcoreTemplate.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Utils.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Workflow.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/WorkflowMain.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/WorkflowMag.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `parameters.settings.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `pipeline_template.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `Singularity` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/nfcore_external_java_deps.jar` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.travis.yml` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.name` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.nextflowVersion` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.description` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.version` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.homePage` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `report.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.cpus` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.memory` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.time` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.outdir` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.input` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.validationShowHiddenParams` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.validationSchemaIgnoreParams` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.mainScript` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `report.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.nf_required_version` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.container` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.singleEnd` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.igenomesIgnore` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.name` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.enable_conda` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``timeline.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``report.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``trace.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``dag.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``manifest.name`` began with ``nf-core/`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.homePage`` began with https://github.com/nf-core/ * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``dag.file`` ended with ``.html`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.nextflowVersion`` started with >= or !>= * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_version` is set to `master` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_base` is set to `https://raw.githubusercontent.com/nf-core/configs/master` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Lines for loading custom profiles found * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - nextflow.config contains configuration profile `test` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/ * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_version= master * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_cpus= 16 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_memory= 128.GB * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_time= 240.h * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.publish_dir_mode= copy * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_multiqc_email_size= 25.MB * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.validate_params= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/ * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.spades_fix_cpus= -1 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.spadeshybrid_fix_cpus= -1 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.metabat_rng_seed= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.clip_tool= fastp * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.reads_minlength= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_qualified_quality= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_cut_mean_quality= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.adapterremoval_minquality= 2 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bbnorm_target= 100 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bbnorm_min= 5 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.longreads_min_length= 1000 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.longreads_keep_percent= 90 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.longreads_length_weight= 10 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_min_completeness= 50.0 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_max_contamination= 10.0 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_min_perc_aa= 10.0 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_min_af= 0.65 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_pplacer_scratch= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.genomad_min_score= 0.7 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.genomad_splits= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.binning_map_mode= group * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.min_contig_size= 1500 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.min_length_unbinned_contigs= 1000000 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_unbinned_contigs= 100 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bin_domain_classification_tool= tiara * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.tiara_min_length= 3000 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.binqc_tool= busco * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.refine_bins_dastool_threshold= 0.5 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.postbinning_input= raw_bins_only * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gunc_database_type= progenomes * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.pydamage_accuracy= 0.5 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.freebayes_ploidy= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.freebayes_min_basequality= 20 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.freebayes_minallelefreq= 0.33 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bcftools_view_high_variant_quality= 30 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bcftools_view_medium_variant_quality= 20 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bcftools_view_minimal_allelesupport= 3 * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.gitattributes` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.prettierrc.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `CODE_OF_CONDUCT.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `LICENSE` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/.dockstore.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/CONTRIBUTING.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/bug_report.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/config.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/feature_request.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/PULL_REQUEST_TEMPLATE.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/branch.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting_comment.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/email_template.html` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/email_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/sendmail_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/nf-core-mag_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-mag_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-mag_logo_dark.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/README.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.gitignore` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.prettierignore` matches the template * [actions_ci](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' is triggered on expected events * [actions_ci](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' checks minimum NF version * [actions_awstest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awstest) - '.github/workflows/awstest.yml' is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` does not use `-profile test` * [readme](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/readme) - README Nextflow minimum version badge matched config. Badge: `23.04.0`, Config: `23.04.0` * [readme](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/readme) - README Zenodo placeholder was replaced with DOI. * [pipeline_name_conventions](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_name_conventions) - Name adheres to nf-core convention * [template_strings](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/template_strings) - Did not find any Jinja template strings (326 files) * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Schema lint passed * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Schema title + description lint passed * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Input mimetype lint passed: 'text/csv' * [schema_params](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_params) - Schema matched params returned from nextflow config * [system_exit](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/system_exit) - No `System.exit` calls found * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awsfulltest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: fix-linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: branch.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting_comment.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awstest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: clean-up.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: release-announcements.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: download_pipeline.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: ci.yml * [merge_markers](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/merge_markers) - No merge markers found in pipeline files * [modules_json](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_json) - Only installed modules found in `modules.json` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` found and not ignored. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `report_section_order` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `export_plots` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `report_comment` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` follows the ordering scheme of the minimally required plugins. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains a matching 'report_comment'. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains 'export_plots: true'. * [modules_structure](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_structure) - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL' * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `conf/base.config` found and not ignored. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `CUSTOM_DUMPSOFTWAREVERSIONS` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `BOWTIE2_HOST_REMOVAL_BUILD` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `BOWTIE2_HOST_REMOVAL_ALIGN` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `BOWTIE2_PHIX_REMOVAL_ALIGN` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `PORECHOP_PORECHOP` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `NANOLYSE` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `FILTLONG` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `CENTRIFUGE_CENTRIFUGE` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `KRAKEN2` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `KRONA_KTIMPORTTAXONOMY` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `CAT_DB_GENERATE` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `CAT` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `GTDBTK_CLASSIFYWF` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `MEGAHIT` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `SPADES` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `SPADESHYBRID` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `BOWTIE2_ASSEMBLY_ALIGN` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `METABAT2_METABAT2` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `MAG_DEPTHS` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `BUSCO` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `MAXBIN2` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `DASTOOL_DASTOOL` found in `conf/base.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `conf/modules.config` found and not ignored. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FASTQC_RAW` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FASTP` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `ADAPTERREMOVAL_PE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `ADAPTERREMOVAL_SE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BOWTIE2_PHIX_REMOVAL_ALIGN` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BOWTIE2_HOST_REMOVAL_ALIGN` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FASTQC_TRIMMED` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BBMAP_BBNORM` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PORECHOP_PORECHOP` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FILTLONG` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NANOLYSE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NANOPLOT_RAW` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NANOPLOT_FILTERED` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CENTRIFUGE_CENTRIFUGE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CENTRIFUGE_KREPORT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `KRAKEN2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `KREPORT2KRONA_CENTRIFUGE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `KRONA_KTIMPORTTAXONOMY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MEGAHIT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SPADES` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SPADESHYBRID` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `QUAST` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GENOMAD_ENDTOEND` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BOWTIE2_ASSEMBLY_ALIGN` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MAG_DEPTHS_PLOT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BIN_SUMMARY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BUSCO_DB_PREPARATION` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BUSCO` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BUSCO_SAVE_DOWNLOAD` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BUSCO_SUMMARY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `ARIA2_UNTAR` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CHECKM_LINEAGEWF` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CHECKM_QA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `COMBINE_CHECKM_TSV` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GUNC_DOWNLOADDB` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GUNC_RUN` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GUNC_MERGECHECKM` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CAT_DB_GENERATE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CAT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CAT_SUMMARY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GTDBTK_CLASSIFYWF` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GTDBTK_SUMMARY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PROKKA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PRODIGAL` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FREEBAYES` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BCFTOOLS_VIEW` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BCFTOOLS_CONSENSUS` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BCFTOOLS_INDEX` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PYDAMAGE_ANALYZE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PYDAMAGE_FILTER` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SAMTOOLS_FAIDX` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `METABAT2_METABAT2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MAXBIN2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `ADJUST_MAXBIN2_EXT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CONCOCT_` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SPLIT_FASTA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `DASTOOL_FASTATOCONTIG2BIN_METABAT2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `DASTOOL_FASTATOCONTIG2BIN_MAXBIN2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `DASTOOL_FASTATOCONTIG2BIN_CONCOCT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `DASTOOL_FASTATOCONTIG2BIN_TIARA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `DASTOOL_DASTOOL` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `RENAME_POSTDASTOOL` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `TIARA_TIARA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `TIARA_CLASSIFY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `TIARA_SUMMARY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MMSEQS_DATABASES` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `METAEUK_EASYPREDICT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MULTIQC` found in `conf/modules.config` and Nextflow scripts. * [nfcore_yml](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nfcore_yml) - Repository type in `.nf-core.yml` is valid: `pipeline` * [nfcore_yml](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nfcore_yml) - nf-core version in `.nf-core.yml` is set to the latest version: `2.14.1` ### Run details * nf-core/tools version 2.14.1 * Run at `2024-07-04 06:37:30`
jfy133 commented 3 days ago

Thank you @prototaxites @mashehu @christopher-hakkaart !