Post release version bump

[jfy133]

PR checklist

• [ ] This comment contains a description of changes (with reason).
• [ ] If you've fixed a bug or added code that should be tested, add tests!
• [ ] If you've added a new tool - have you followed the pipeline conventions in the contribution docs
• [ ] If necessary, also make a PR on the nf-core/mag branch on the nf-core/test-datasets repository.
• [ ] Make sure your code lints (nf-core lint).
• [ ] Ensure the test suite passes (nextflow run . -profile test,docker --outdir <OUTDIR>).
• [ ] Check for unexpected warnings in debug mode (nextflow run . -profile debug,test,docker --outdir <OUTDIR>).
• [ ] Usage Documentation in docs/usage.md is updated.
• [ ] Output Documentation in docs/output.md is updated.
• [ ] CHANGELOG.md is updated.
• [ ] README.md is updated (including new tool citations and authors/contributors).

[github-actions[bot]]

This PR is against the master branch :x:

• Do not close this PR
• Click Edit and change the base to dev
• This CI test will remain failed until you push a new commit

---

Hi @jfy133,

It looks like this pull-request is has been made against the nf-core/mag master branch. The master branch on nf-core repositories should always contain code from the latest release. Because of this, PRs to master are only allowed if they come from the nf-core/mag dev branch.

You do not need to close this PR, you can change the target branch to dev by clicking the "Edit" button at the top of this page. Note that even after this, the test will continue to show as failing until you push a new commit.

Thanks again for your contribution!

[github-actions[bot]]

nf-core lint overall result: Passed :white_check_mark: :warning:

Posted for pipeline commit 127e394

+| ✅ 307 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗   5 tests had warnings |!

### :heavy_exclamation_mark: Test warnings: * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]_ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Optionally add in-text citation tools to this list._ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Optionally add bibliographic entries to this list._ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!_ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `methods_description_template.yml`: _#Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline_ ### :grey_question: Tests ignored: * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default ignored: params.phix_reference * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default ignored: params.lambda_reference ### :white_check_mark: Tests passed: * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.gitattributes` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.gitignore` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.nf-core.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.editorconfig` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.prettierignore` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.prettierrc.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CHANGELOG.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CITATIONS.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CODE_OF_CONDUCT.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `LICENSE` or `LICENSE.md` or `LICENCE` or `LICENCE.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `nextflow_schema.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `nextflow.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/.dockstore.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/CONTRIBUTING.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/bug_report.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/config.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/feature_request.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/PULL_REQUEST_TEMPLATE.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/branch.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/ci.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting_comment.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/email_template.html` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/email_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/sendmail_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/nf-core-mag_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/modules.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/test.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/test_full.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-mag_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-mag_logo_dark.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/output.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/usage.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `main.nf` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/multiqc_config.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/base.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/igenomes.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awstest.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awsfulltest.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `modules.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/bug_report.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/feature_request.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/workflows/push_dockerhub.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.markdownlint.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.nf-core.yaml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.yamllint.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `bin/markdown_to_html.r` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `conf/aws.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `docs/images/nf-core-mag_logo.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Checks.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Completion.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/NfcoreTemplate.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Utils.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Workflow.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/WorkflowMain.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/WorkflowMag.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `parameters.settings.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `pipeline_template.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `Singularity` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/nfcore_external_java_deps.jar` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.travis.yml` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.name` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.nextflowVersion` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.description` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.version` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.homePage` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `report.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.cpus` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.memory` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.time` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.outdir` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.input` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.validationShowHiddenParams` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.validationSchemaIgnoreParams` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.mainScript` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `report.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.nf_required_version` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.container` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.singleEnd` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.igenomesIgnore` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.name` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.enable_conda` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``timeline.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``report.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``trace.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``dag.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``manifest.name`` began with ``nf-core/`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.homePage`` began with https://github.com/nf-core/ * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``dag.file`` ended with ``.html`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.nextflowVersion`` started with >= or !>= * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``manifest.version`` ends in ``dev``: ``dev`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_version` is set to `master` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_base` is set to `https://raw.githubusercontent.com/nf-core/configs/master` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Lines for loading custom profiles found * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - nextflow.config contains configuration profile `test` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/ * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_version= master * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_cpus= 16 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_memory= 128.GB * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_time= 240.h * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.publish_dir_mode= copy * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_multiqc_email_size= 25.MB * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.validate_params= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/ * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.spades_fix_cpus= -1 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.spadeshybrid_fix_cpus= -1 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.metabat_rng_seed= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.clip_tool= fastp * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.reads_minlength= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_qualified_quality= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_cut_mean_quality= 15 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.adapterremoval_minquality= 2 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bbnorm_target= 100 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bbnorm_min= 5 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.longreads_min_length= 1000 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.longreads_keep_percent= 90 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.longreads_length_weight= 10 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_min_completeness= 50.0 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_max_contamination= 10.0 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_min_perc_aa= 10.0 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_min_af= 0.65 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gtdbtk_pplacer_scratch= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.genomad_min_score= 0.7 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.genomad_splits= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.binning_map_mode= group * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.min_contig_size= 1500 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.min_length_unbinned_contigs= 1000000 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_unbinned_contigs= 100 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bin_domain_classification_tool= tiara * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.tiara_min_length= 3000 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.binqc_tool= busco * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.refine_bins_dastool_threshold= 0.5 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.postbinning_input= raw_bins_only * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.gunc_database_type= progenomes * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.pydamage_accuracy= 0.5 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.freebayes_ploidy= 1 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.freebayes_min_basequality= 20 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.freebayes_minallelefreq= 0.33 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bcftools_view_high_variant_quality= 30 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bcftools_view_medium_variant_quality= 20 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.bcftools_view_minimal_allelesupport= 3 * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.gitattributes` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.prettierrc.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `CODE_OF_CONDUCT.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `LICENSE` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/.dockstore.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/CONTRIBUTING.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/bug_report.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/config.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/feature_request.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/PULL_REQUEST_TEMPLATE.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/branch.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting_comment.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/email_template.html` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/email_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/sendmail_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/nf-core-mag_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-mag_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-mag_logo_dark.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/README.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.gitignore` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.prettierignore` matches the template * [actions_ci](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' is triggered on expected events * [actions_ci](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' checks minimum NF version * [actions_awstest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awstest) - '.github/workflows/awstest.yml' is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` does not use `-profile test` * [readme](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/readme) - README Nextflow minimum version badge matched config. Badge: `23.04.0`, Config: `23.04.0` * [readme](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/readme) - README Zenodo placeholder was replaced with DOI. * [pipeline_name_conventions](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_name_conventions) - Name adheres to nf-core convention * [template_strings](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/template_strings) - Did not find any Jinja template strings (326 files) * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Schema lint passed * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Schema title + description lint passed * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Input mimetype lint passed: 'text/csv' * [schema_params](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_params) - Schema matched params returned from nextflow config * [system_exit](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/system_exit) - No `System.exit` calls found * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awsfulltest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: fix-linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: branch.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting_comment.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awstest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: clean-up.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: release-announcements.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: download_pipeline.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: ci.yml * [merge_markers](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/merge_markers) - No merge markers found in pipeline files * [modules_json](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_json) - Only installed modules found in `modules.json` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` found and not ignored. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `report_section_order` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `export_plots` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `report_comment` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` follows the ordering scheme of the minimally required plugins. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains a matching 'report_comment'. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains 'export_plots: true'. * [modules_structure](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_structure) - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL' * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `conf/base.config` found and not ignored. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `CUSTOM_DUMPSOFTWAREVERSIONS` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `BOWTIE2_HOST_REMOVAL_BUILD` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `BOWTIE2_HOST_REMOVAL_ALIGN` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `BOWTIE2_PHIX_REMOVAL_ALIGN` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `PORECHOP_PORECHOP` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `NANOLYSE` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `FILTLONG` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `CENTRIFUGE_CENTRIFUGE` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `KRAKEN2` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `KRONA_KTIMPORTTAXONOMY` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `CAT_DB_GENERATE` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `CAT` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `GTDBTK_CLASSIFYWF` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `MEGAHIT` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `SPADES` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `SPADESHYBRID` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `BOWTIE2_ASSEMBLY_ALIGN` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `METABAT2_METABAT2` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `MAG_DEPTHS` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `BUSCO` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `MAXBIN2` found in `conf/base.config` and Nextflow scripts. * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `DASTOOL_DASTOOL` found in `conf/base.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `conf/modules.config` found and not ignored. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FASTQC_RAW` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FASTP` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `ADAPTERREMOVAL_PE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `ADAPTERREMOVAL_SE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BOWTIE2_PHIX_REMOVAL_ALIGN` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BOWTIE2_HOST_REMOVAL_ALIGN` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FASTQC_TRIMMED` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BBMAP_BBNORM` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PORECHOP_PORECHOP` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FILTLONG` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NANOLYSE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NANOPLOT_RAW` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NANOPLOT_FILTERED` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CENTRIFUGE_CENTRIFUGE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CENTRIFUGE_KREPORT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `KRAKEN2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `KREPORT2KRONA_CENTRIFUGE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `KRONA_KTIMPORTTAXONOMY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MEGAHIT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SPADES` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SPADESHYBRID` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `QUAST` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GENOMAD_ENDTOEND` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BOWTIE2_ASSEMBLY_ALIGN` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MAG_DEPTHS_PLOT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BIN_SUMMARY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BUSCO_DB_PREPARATION` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BUSCO` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BUSCO_SAVE_DOWNLOAD` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BUSCO_SUMMARY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `ARIA2_UNTAR` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CHECKM_LINEAGEWF` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CHECKM_QA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `COMBINE_CHECKM_TSV` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GUNC_DOWNLOADDB` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GUNC_RUN` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GUNC_MERGECHECKM` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CAT_DB_GENERATE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CAT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CAT_SUMMARY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GTDBTK_CLASSIFYWF` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `GTDBTK_SUMMARY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PROKKA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PRODIGAL` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FREEBAYES` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BCFTOOLS_VIEW` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BCFTOOLS_CONSENSUS` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `BCFTOOLS_INDEX` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PYDAMAGE_ANALYZE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PYDAMAGE_FILTER` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SAMTOOLS_FAIDX` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `METABAT2_METABAT2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MAXBIN2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `ADJUST_MAXBIN2_EXT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CONCOCT_` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SPLIT_FASTA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `DASTOOL_FASTATOCONTIG2BIN_METABAT2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `DASTOOL_FASTATOCONTIG2BIN_MAXBIN2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `DASTOOL_FASTATOCONTIG2BIN_CONCOCT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `DASTOOL_FASTATOCONTIG2BIN_TIARA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `DASTOOL_DASTOOL` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `RENAME_POSTDASTOOL` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `TIARA_TIARA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `TIARA_CLASSIFY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `TIARA_SUMMARY` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MMSEQS_DATABASES` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `METAEUK_EASYPREDICT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MULTIQC` found in `conf/modules.config` and Nextflow scripts. * [nfcore_yml](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nfcore_yml) - Repository type in `.nf-core.yml` is valid: `pipeline` * [nfcore_yml](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nfcore_yml) - nf-core version in `.nf-core.yml` is set to the latest version: `2.14.1` ### Run details * nf-core/tools version 2.14.1 * Run at `2024-07-04 06:46:52`