Nextflex paired-end sequencing

sav0016 commented 8 months ago

Hello,

I am trying to run nextflex 150bp paired end data. If I use only R1 so it works. I am not able to pass with both reads. Thanks.

N E X T F L O W ~ version 23.10.1 Launching/home/data3/.nextflow/assets/nf-core/smrnaseq/main.nf[loving_dijkstra] DSL2 - revision: baab1a8371 WARN: Running with Protocol nextflex WARN: Therefore using Adapter: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA WARN: Clipping 4 bases from R1 WARN: And clipping 4 bases from 3' end WARN: Access to undefined parametermonochromeLogs-- Initialise it to a default value eg.params.monochromeLogs = some_value`

                                    ,--./,-.
    ___     __   __   __   ___     /,-._.--~'

|\ | | / `/ \ |) | } { | \| | \, \/ | \ |___ \`-.,-`-,` .,._,' nf-core/smrnaseq v2.3.0

Core Nextflow options runName : loving_dijkstra containerEngine : docker launchDir : /data3/data3/smrnaseq/nextflex/24-03-04/paired workDir : /data3/data3/smrnaseq/nextflex/24-03-04/paired/work projectDir : /home/data3/.nextflow/assets/nf-core/smrnaseq userName : user profile : docker configFiles :

Input/output options input : samplesheet.csv protocol : nextflex outdir : ./results

Reference genome options genome : hg38 mirtrace_species: hsa fasta : s3://ngi-igenomes/igenomes//Homo_sapiens/UCSC/hg38/Sequence/WholeGenomeFasta/genome.fa

!! Only displaying parameters that differ from the pipeline defaults !!

If you use nf-core/smrnaseq for your analysis please cite:

The pipeline 10.5281/zenodo.3456879
The nf-core framework https://doi.org/10.1038/s41587-020-0439-x
Software dependencies https://github.com/nf-core/smrnaseq/blob/master/CITATIONS.md

WARN: Access to undefined parameter fasta -- Initialise it to a default value eg. params.fasta = some_value [37/add4b7] Submitted process > NFCORE_SMRNASEQ:CAT_FASTQ (S16) [5e/5ef3d1] Submitted process > NFCORE_SMRNASEQ:CAT_FASTQ (S15) [a6/4f3839] Submitted process > NFCORE_SMRNASEQ:CAT_FASTQ (S14) [84/5eda58] Submitted process > NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (S15) [5d/dec972] Submitted process > NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (S15) Staging foreign file: https://mirbase.org/download/mature.fa Staging foreign file: https://mirbase.org/download/hairpin.fa [d5/fe266e] Submitted process > NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (S14) [cd/ff36f6] Submitted process > NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (S14) [30/8e67a3] Submitted process > NFCORE_SMRNASEQ:MIRNA_QUANT:PARSE_HAIRPIN [b8/34359a] Submitted process > NFCORE_SMRNASEQ:MIRNA_QUANT:PARSE_MATURE [98/b3083e] Submitted process > NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_RAW (S16) [9f/0f269a] Submitted process > NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTP (S16) [41/6535e3] Submitted process > NFCORE_SMRNASEQ:MIRNA_QUANT:FORMAT_HAIRPIN (hairpin.fa_igenome.fa) [21/91aa97] Submitted process > NFCORE_SMRNASEQ:MIRNA_QUANT:FORMAT_MATURE (mature.fa_igenome.fa) [47/b9444c] Submitted process > NFCORE_SMRNASEQ:MIRNA_QUANT:INDEX_HAIRPIN [74/ee88fa] Submitted process > NFCORE_SMRNASEQ:MIRNA_QUANT:INDEX_MATURE [37/61d751] Submitted process > NFCORE_SMRNASEQ:MIRNA_QUANT:SEQCLUSTER_SEQUENCES (S15_seqcluster) [55/80b48c] Submitted process > NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_TRIM (S15) [c5/1eb7a3] Submitted process > NFCORE_SMRNASEQ:MIRNA_QUANT:BOWTIE_MAP_MATURE (S15_mature) [43/6100f2] Submitted process > NFCORE_SMRNASEQ:MIRNA_QUANT:SEQCLUSTER_SEQUENCES (S14_seqcluster) [bc/d58e24] Submitted process > NFCORE_SMRNASEQ:FASTQ_FASTQC_UMITOOLS_FASTP:FASTQC_TRIM (S14) [27/b4a18c] Submitted process > NFCORE_SMRNASEQ:MIRNA_QUANT:BOWTIE_MAP_MATURE (S14_mature) ERROR ~ Error executing process > 'NFCORE_SMRNASEQ:MIRNA_QUANT:SEQCLUSTER_SEQUENCES (S15_seqcluster)'

Caused by: Process NFCORE_SMRNASEQ:MIRNA_QUANT:SEQCLUSTER_SEQUENCES (S15_seqcluster) terminated with an error exit status (2)

Command executed:

seqcluster collapse -f S15_1.fastp.fastq.gz S15_2.fastp.fastq.gz -m 1 --min_size 15 -o collapsed gzip collapsed/_trimmed.fastq mkdir final mv collapsed/.fastq.gz final/.

cat <<-END_VERSIONS > versions.yml "NFCORE_SMRNASEQ:MIRNA_QUANT:SEQCLUSTER_SEQUENCES": seqcluster: $(echo $(seqcluster --version 2>&1) | sed 's/^.*seqcluster //') END_VERSIONS

Command exit status: 2

Command output: Probably this will fail, you need bcbio-nextgen for many installation functions. ['collapse', '-f', 'S15_1.fastp.fastq.gz', 'S15_2.fastp.fastq.gz', '-m', '1', '--min_size', '15', '-o', 'collapsed']

Command error: Probably this will fail, you need bcbio-nextgen for many installation functions. ['collapse', '-f', 'S15_1.fastp.fastq.gz', 'S15_2.fastp.fastq.gz', '-m', '1', '--min_size', '15', '-o', 'collapsed'] usage: seqcluster [-h] [--version] {collapse} ... seqcluster: error: unrecognized arguments: S15_2.fastp.fastq.gz

Work dir: /data3/data3/smrnaseq/nextflex/24-03-04/paired/work/37/61d751b11bc2b8374a17fd33ab8838

Tip: you can replicate the issue by changing to the process work dir and entering the command bash .command.run

-- Check '.nextflow.log' file for details Execution cancelled -- Finishing pending tasks before exit -[nf-core/smrnaseq] Pipeline completed with errors- `

lpantano commented 8 months ago

Hi, that is correct, the protocol for small-RNAseq is single end. Can you tell us more about your samples? are they expected to be sequences < 40nts? or they are expected to be in the 100 to 200nt long? Normally the sequencing protocols is targeting miRNAs (mainly), what was the intention of your experiment, if you cans share?

sav0016 commented 8 months ago

@lpantano thank you for your answer! We normally sequence our samples paired-end 150bp. smrnaseq works great using the first read only. Yes, we are targeting miRNA so inserts are small. So the conclusion is just to ignore R2 and use only R1, right? Not merge them somehow ...

lpantano commented 8 months ago

Yes, that should work! thank you!

nf-core / smrnaseq