nf-core / smrnaseq

A small-RNA sequencing analysis pipeline
https://nf-co.re/smrnaseq
MIT License
74 stars 125 forks source link

Add `config` mode to nf-core `mirtrace/qc` #420

Closed atrigila closed 2 months ago

atrigila commented 2 months ago

Fixes #419

PR checklist

github-actions[bot] commented 2 months ago

nf-core lint overall result: Passed :white_check_mark: :warning:

Posted for pipeline commit 5d39fc9

+| ✅ 217 tests passed       |+
#| ❔   1 tests were ignored |#
!| ❗   3 tests had warnings |!
### :heavy_exclamation_mark: Test warnings: * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Optionally add in-text citation tools to this list._ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Optionally add bibliographic entries to this list._ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!_ ### :grey_question: Tests ignored: * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default ignored: params.fastp_known_mirna_adapters ### :white_check_mark: Tests passed: * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.gitattributes` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.gitignore` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.nf-core.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.editorconfig` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.prettierignore` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.prettierrc.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CHANGELOG.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CITATIONS.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CODE_OF_CONDUCT.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `LICENSE` or `LICENSE.md` or `LICENCE` or `LICENCE.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `nextflow_schema.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `nextflow.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/.dockstore.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/CONTRIBUTING.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/bug_report.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/config.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/feature_request.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/PULL_REQUEST_TEMPLATE.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/branch.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/ci.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting_comment.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/email_template.html` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/email_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/sendmail_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/nf-core-smrnaseq_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/modules.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/test.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/test_full.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-smrnaseq_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-smrnaseq_logo_dark.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/output.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/usage.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `main.nf` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/multiqc_config.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/base.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/igenomes.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awstest.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awsfulltest.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `modules.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/bug_report.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/feature_request.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/workflows/push_dockerhub.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.markdownlint.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.nf-core.yaml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.yamllint.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `bin/markdown_to_html.r` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `conf/aws.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `docs/images/nf-core-smrnaseq_logo.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Checks.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Completion.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/NfcoreTemplate.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Utils.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Workflow.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/WorkflowMain.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/WorkflowSmrnaseq.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `parameters.settings.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `pipeline_template.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `Singularity` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/nfcore_external_java_deps.jar` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.travis.yml` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.name` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.nextflowVersion` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.description` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.version` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.homePage` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `report.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.cpus` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.memory` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.time` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.outdir` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.input` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.validationShowHiddenParams` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.validationSchemaIgnoreParams` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.mainScript` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `report.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.nf_required_version` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.container` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.singleEnd` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.igenomesIgnore` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.name` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.enable_conda` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``timeline.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``report.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``trace.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``dag.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``manifest.name`` began with ``nf-core/`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.homePage`` began with https://github.com/nf-core/ * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``dag.file`` ended with ``.html`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.nextflowVersion`` started with >= or !>= * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``manifest.version`` ends in ``dev``: ``2.3.2dev`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_version` is set to `master` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_base` is set to `https://raw.githubusercontent.com/nf-core/configs/master` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Lines for loading custom profiles found * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - nextflow.config contains configuration profile `test` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.protocol= custom * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.umitools_extract_method= string * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.umitools_method= dir * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.skip_umi_extract_before_dedup= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.mature= https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/mature.fa * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.hairpin= https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/hairpin.fa * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.save_aligned_mirna_quant= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.three_prime_adapter= AGATCGGAAGAGCACACGTCTGAACTCCAGTCA * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.trim_fastq= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_min_length= 17 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_max_length= 100 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.min_trimmed_reads= 10 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.save_merged= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.phred_offset= 33 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_version= master * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_cpus= 16 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_memory= 128.GB * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_time= 240.h * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.publish_dir_mode= copy * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_multiqc_email_size= 25.MB * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.validate_params= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/ * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.gitattributes` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.prettierrc.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `CODE_OF_CONDUCT.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `LICENSE` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/.dockstore.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/CONTRIBUTING.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/bug_report.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/config.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/feature_request.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/PULL_REQUEST_TEMPLATE.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/branch.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting_comment.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/email_template.html` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/email_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/sendmail_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/nf-core-smrnaseq_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-smrnaseq_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-smrnaseq_logo_dark.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/README.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.gitignore` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.prettierignore` matches the template * [actions_ci](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' is triggered on expected events * [actions_ci](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' checks minimum NF version * [actions_awstest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awstest) - '.github/workflows/awstest.yml' is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` does not use `-profile test` * [readme](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/readme) - README Nextflow minimum version badge matched config. Badge: `23.04.0`, Config: `23.04.0` * [readme](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/readme) - README Zenodo placeholder was replaced with DOI. * [pipeline_name_conventions](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_name_conventions) - Name adheres to nf-core convention * [template_strings](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/template_strings) - Did not find any Jinja template strings (269 files) * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Schema lint passed * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Schema title + description lint passed * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Input mimetype lint passed: 'text/csv' * [schema_params](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_params) - Schema matched params returned from nextflow config * [system_exit](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/system_exit) - No `System.exit` calls found * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: branch.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: fix-linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: download_pipeline.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: release-announcements.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: clean-up.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awsfulltest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting_comment.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awstest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: ci.yml * [merge_markers](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/merge_markers) - No merge markers found in pipeline files * [modules_json](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_json) - Only installed modules found in `modules.json` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` found and not ignored. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `report_section_order` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `export_plots` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `report_comment` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` follows the ordering scheme of the minimally required plugins. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains a matching 'report_comment'. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains 'export_plots: true'. * [modules_structure](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_structure) - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL' * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `conf/base.config` found and not ignored. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `conf/modules.config` found and not ignored. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CAT_FASTQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FASTP_LENGTH_FILTER` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `INDEX_GENOME` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `UMITOOLS_EXTRACT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MIRTRACE_QC` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `EDGER_QC` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SEQCLUSTER_SEQUENCES` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MIRTOP_QUANT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SAMTOOLS_INDEX` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MULTIQC` found in `conf/modules.config` and Nextflow scripts. * [nfcore_yml](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nfcore_yml) - Repository type in `.nf-core.yml` is valid: `pipeline` * [nfcore_yml](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nfcore_yml) - nf-core version in `.nf-core.yml` is set to the latest version: `2.14.1` ### Run details * nf-core/tools version 2.14.1 * Run at `2024-09-11 15:22:57`
atrigila commented 2 months ago

Some tests are failing (and will be updated) because the new module changed the way of naming the samples in the mirtrace files. Originally, it used the name of the file e.g.https://github.com/nf-core/test-datasets/raw/smrnaseq/testdata/trimmed/small_Clone1_N1.fastp.fastq.gz while it now uses the sample id from the samplesheet which is more appropriate.

original naming: image

current naming: image