nf-core / smrnaseq

A small-RNA sequencing analysis pipeline
https://nf-co.re/smrnaseq
MIT License
74 stars 125 forks source link

Migrate to nf-core `bowtie align` in contaminant filter #441

Closed atrigila closed 2 months ago

atrigila commented 2 months ago

436

The scope of this PR is to migrate all instances of local bowtie to nf-core bowtie. The code in contaminant filter can still be heavily refactored but this is part of #406 .

PR checklist

github-actions[bot] commented 2 months ago

nf-core lint overall result: Passed :white_check_mark: :warning:

Posted for pipeline commit 1438a91

+| ✅ 231 tests passed       |+
#| ❔   1 tests were ignored |#
!| ❗   3 tests had warnings |!
### :heavy_exclamation_mark: Test warnings: * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Optionally add in-text citation tools to this list._ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Optionally add bibliographic entries to this list._ * [pipeline_todos](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_todos) - TODO string in `main.nf`: _Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!_ ### :grey_question: Tests ignored: * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default ignored: params.fastp_known_mirna_adapters ### :white_check_mark: Tests passed: * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.gitattributes` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.gitignore` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.nf-core.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.editorconfig` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.prettierignore` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.prettierrc.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CHANGELOG.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CITATIONS.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `CODE_OF_CONDUCT.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `LICENSE` or `LICENSE.md` or `LICENCE` or `LICENCE.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `nextflow_schema.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `nextflow.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/.dockstore.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/CONTRIBUTING.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/bug_report.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/config.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/feature_request.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/PULL_REQUEST_TEMPLATE.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/branch.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/ci.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting_comment.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/email_template.html` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/email_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/sendmail_template.txt` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/nf-core-smrnaseq_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/modules.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/test.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/test_full.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-smrnaseq_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-smrnaseq_logo_dark.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/output.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `docs/usage.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `main.nf` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `assets/multiqc_config.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/base.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `conf/igenomes.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awstest.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awsfulltest.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File found: `modules.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/bug_report.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/feature_request.md` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.github/workflows/push_dockerhub.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.markdownlint.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.nf-core.yaml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.yamllint.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `bin/markdown_to_html.r` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `conf/aws.config` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `docs/images/nf-core-smrnaseq_logo.png` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Checks.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Completion.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/NfcoreTemplate.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Utils.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/Workflow.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/WorkflowMain.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/WorkflowSmrnaseq.groovy` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `parameters.settings.json` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `pipeline_template.yml` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `Singularity` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `lib/nfcore_external_java_deps.jar` * [files_exist](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_exist) - File not found check: `.travis.yml` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.name` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.nextflowVersion` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.description` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.version` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.homePage` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `report.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.enabled` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.cpus` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.memory` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `process.time` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.outdir` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.input` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.validationShowHiddenParams` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `params.validationSchemaIgnoreParams` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.mainScript` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `report.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.file` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.nf_required_version` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.container` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.singleEnd` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.igenomesIgnore` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.name` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.enable_conda` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``timeline.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``report.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``trace.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``dag.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``manifest.name`` began with ``nf-core/`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.homePage`` began with https://github.com/nf-core/ * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``dag.file`` ended with ``.html`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.nextflowVersion`` started with >= or !>= * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config ``manifest.version`` ends in ``dev``: ``2.3.2dev`` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_version` is set to `master` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_base` is set to `https://raw.githubusercontent.com/nf-core/configs/master` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Lines for loading custom profiles found * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - nextflow.config contains configuration profile `test` * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.protocol= custom * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.umitools_extract_method= string * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.umitools_method= dir * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.skip_umi_extract_before_dedup= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.mature= https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/mature.fa * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.hairpin= https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/hairpin.fa * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.three_prime_adapter= AGATCGGAAGAGCACACGTCTGAACTCCAGTCA * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.trim_fastq= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_min_length= 17 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_max_length= 100 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.min_trimmed_reads= 10 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.save_merged= false * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.phred_offset= 33 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_version= master * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_cpus= 16 * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_memory= 128.GB * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_time= 240.h * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.publish_dir_mode= copy * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_multiqc_email_size= 25.MB * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.validate_params= true * [nextflow_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nextflow_config) - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/ * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.gitattributes` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.prettierrc.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `CODE_OF_CONDUCT.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `LICENSE` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/.dockstore.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/CONTRIBUTING.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/bug_report.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/config.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/feature_request.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/PULL_REQUEST_TEMPLATE.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/branch.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting_comment.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/email_template.html` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/email_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/sendmail_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `assets/nf-core-smrnaseq_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-smrnaseq_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-smrnaseq_logo_dark.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `docs/README.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.gitignore` matches the template * [files_unchanged](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/files_unchanged) - `.prettierignore` matches the template * [actions_ci](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' is triggered on expected events * [actions_ci](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' checks minimum NF version * [actions_awstest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awstest) - '.github/workflows/awstest.yml' is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` does not use `-profile test` * [readme](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/readme) - README Nextflow minimum version badge matched config. Badge: `23.10.4`, Config: `23.10.4` * [readme](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/readme) - README Zenodo placeholder was replaced with DOI. * [pipeline_name_conventions](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/pipeline_name_conventions) - Name adheres to nf-core convention * [template_strings](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/template_strings) - Did not find any Jinja template strings (339 files) * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Schema lint passed * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Schema title + description lint passed * [schema_lint](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_lint) - Input mimetype lint passed: 'text/csv' * [schema_params](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/schema_params) - Schema matched params returned from nextflow config * [system_exit](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/system_exit) - No `System.exit` calls found * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: ci.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awsfulltest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting_comment.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: release-announcements.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: download_pipeline.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awstest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: clean-up.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: fix-linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: branch.yml * [merge_markers](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/merge_markers) - No merge markers found in pipeline files * [modules_json](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_json) - Only installed modules found in `modules.json` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` found and not ignored. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `report_section_order` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `export_plots` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `report_comment` * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` follows the ordering scheme of the minimally required plugins. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains a matching 'report_comment'. * [multiqc_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains 'export_plots: true'. * [modules_structure](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_structure) - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL' * [base_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/base_config) - `conf/base.config` found and not ignored. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `conf/modules.config` found and not ignored. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CAT_FASTQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `UNTAR` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `FASTP_LENGTH_FILTER` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `INDEX_GENOME` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `CLEAN_FASTA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `UMITOOLS_EXTRACT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MIRTRACE_QC` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `EDGER_QC` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SEQCLUSTER_COLLAPSE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `SAMTOOLS_INDEX` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `PIGZ_UNCOMPRESS` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/modules_config) - `MULTIQC` found in `conf/modules.config` and Nextflow scripts. * [nfcore_yml](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nfcore_yml) - Repository type in `.nf-core.yml` is valid: `pipeline` * [nfcore_yml](https://nf-co.re/tools/docs/2.14.1/pipeline_lint_tests/nfcore_yml) - nf-core version in `.nf-core.yml` is set to the latest version: `2.14.1` ### Run details * nf-core/tools version 2.14.1 * Run at `2024-09-25 18:26:53`