nf-core / smrnaseq

A small-RNA sequencing analysis pipeline
https://nf-co.re/smrnaseq
MIT License
74 stars 125 forks source link

Adress issues from review #469

Closed apeltzer closed 1 month ago

apeltzer commented 1 month ago

PR checklist

github-actions[bot] commented 1 month ago

nf-core pipelines lint overall result: Passed :white_check_mark: :warning:

Posted for pipeline commit 5254dae

+| ✅ 243 tests passed       |+
#| ❔   1 tests were ignored |#
!| ❗   2 tests had warnings |!
### :heavy_exclamation_mark: Test warnings: * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config ``manifest.version`` should end in ``dev``: ``2.4.0`` * [schema_description](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/schema_description) - Ungrouped param in schema: `igenomes_base` ### :grey_question: Tests ignored: * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default ignored: params.fastp_known_mirna_adapters ### :white_check_mark: Tests passed: * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.gitattributes` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.gitignore` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.nf-core.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.editorconfig` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.prettierignore` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.prettierrc.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `CHANGELOG.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `CITATIONS.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `CODE_OF_CONDUCT.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `LICENSE` or `LICENSE.md` or `LICENCE` or `LICENCE.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `nextflow_schema.json` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `nextflow.config` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `README.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/.dockstore.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/CONTRIBUTING.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/bug_report.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/config.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/ISSUE_TEMPLATE/feature_request.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/PULL_REQUEST_TEMPLATE.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/workflows/branch.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/workflows/ci.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting_comment.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/workflows/linting.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `assets/email_template.html` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `assets/email_template.txt` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `assets/sendmail_template.txt` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `assets/nf-core-smrnaseq_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `conf/modules.config` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `conf/test.config` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `conf/test_full.config` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-smrnaseq_logo_light.png` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `docs/images/nf-core-smrnaseq_logo_dark.png` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `docs/output.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `docs/README.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `docs/usage.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `main.nf` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `assets/multiqc_config.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `conf/base.config` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `conf/igenomes.config` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `conf/igenomes_ignored.config` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awstest.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `.github/workflows/awsfulltest.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File found: `modules.json` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/bug_report.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `.github/ISSUE_TEMPLATE/feature_request.md` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `.github/workflows/push_dockerhub.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `.markdownlint.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `.nf-core.yaml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `.yamllint.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `bin/markdown_to_html.r` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `conf/aws.config` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `docs/images/nf-core-smrnaseq_logo.png` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `lib/Checks.groovy` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `lib/Completion.groovy` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `lib/NfcoreTemplate.groovy` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `lib/Utils.groovy` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `lib/Workflow.groovy` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `lib/WorkflowMain.groovy` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `lib/WorkflowSmrnaseq.groovy` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `parameters.settings.json` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `pipeline_template.yml` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `Singularity` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `lib/nfcore_external_java_deps.jar` * [files_exist](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_exist) - File not found check: `.travis.yml` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Found nf-schema plugin * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.name` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.nextflowVersion` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.description` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.version` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.homePage` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.enabled` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.enabled` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `report.enabled` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.enabled` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `process.cpus` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `process.memory` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `process.time` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `params.outdir` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `params.input` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `validation.help.enabled` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `manifest.mainScript` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `timeline.file` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `trace.file` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `report.file` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `dag.file` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `validation.help.beforeText` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `validation.help.afterText` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `validation.help.command` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `validation.summary.beforeText` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable found: `validation.summary.afterText` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.nf_required_version` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.container` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.singleEnd` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.igenomesIgnore` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.name` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.enable_conda` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.max_cpus` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.max_memory` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.max_time` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.validationFailUnrecognisedParams` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.validationLenientMode` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.validationSchemaIgnoreParams` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable (correctly) not found: `params.validationShowHiddenParams` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config ``timeline.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config ``report.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config ``trace.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config ``dag.enabled`` had correct value: ``true`` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config ``manifest.name`` began with ``nf-core/`` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.homePage`` began with https://github.com/nf-core/ * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config ``dag.file`` ended with ``.html`` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config variable ``manifest.nextflowVersion`` started with >= or !>= * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_version` is set to `master` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config `params.custom_config_base` is set to `https://raw.githubusercontent.com/nf-core/configs/master` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Lines for loading custom profiles found * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - nextflow.config contains configuration profile `test` * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/ * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.umitools_extract_method= string * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.umitools_method= dir * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.skip_umi_extract_before_dedup= true * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.mature= https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/mature.fa * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.hairpin= https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/hairpin.fa * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.three_prime_adapter= AGATCGGAAGAGCACACGTCTGAACTCCAGTCA * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.trim_fastq= true * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_min_length= 17 * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.fastp_max_length= 100 * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.min_trimmed_reads= 10 * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.save_merged= false * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.phred_offset= 33 * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_version= master * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.publish_dir_mode= copy * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.max_multiqc_email_size= 25.MB * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.validate_params= true * [nextflow_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nextflow_config) - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/ * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.gitattributes` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.prettierrc.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `CODE_OF_CONDUCT.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `LICENSE` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.github/.dockstore.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.github/CONTRIBUTING.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/bug_report.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/config.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.github/ISSUE_TEMPLATE/feature_request.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.github/PULL_REQUEST_TEMPLATE.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.github/workflows/branch.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting_comment.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.github/workflows/linting.yml` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `assets/email_template.html` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `assets/email_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `assets/sendmail_template.txt` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `assets/nf-core-smrnaseq_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-smrnaseq_logo_light.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `docs/images/nf-core-smrnaseq_logo_dark.png` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `docs/README.md` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.gitignore` matches the template * [files_unchanged](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/files_unchanged) - `.prettierignore` matches the template * [actions_ci](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' is triggered on expected events * [actions_ci](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_ci) - '.github/workflows/ci.yml' checks minimum NF version * [actions_awstest](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_awstest) - '.github/workflows/awstest.yml' is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` is triggered correctly * [actions_awsfulltest](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_awsfulltest) - `.github/workflows/awsfulltest.yml` does not use `-profile test` * [readme](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/readme) - README Nextflow minimum version badge matched config. Badge: `24.04.2`, Config: `24.04.2` * [readme](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/readme) - README Zenodo placeholder was replaced with DOI. * [pipeline_todos](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/pipeline_todos) - No TODO strings found * [plugin_includes](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/plugin_includes) - No wrong validation plugin imports have been found * [pipeline_name_conventions](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/pipeline_name_conventions) - Name adheres to nf-core convention * [template_strings](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/template_strings) - Did not find any Jinja template strings (0 files) * [schema_lint](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/schema_lint) - Schema lint passed * [schema_lint](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/schema_lint) - Schema title + description lint passed * [schema_lint](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/schema_lint) - Input mimetype lint passed: 'text/csv' * [schema_params](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/schema_params) - Schema matched params returned from nextflow config * [system_exit](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/system_exit) - No `System.exit` calls found * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: branch.yml * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: fix-linting.yml * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: release-announcements.yml * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awsfulltest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: template_version_comment.yml * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: download_pipeline.yml * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: ci.yml * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: clean-up.yml * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: awstest.yml * [actions_schema_validation](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/actions_schema_validation) - Workflow validation passed: linting_comment.yml * [merge_markers](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/merge_markers) - No merge markers found in pipeline files * [modules_json](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_json) - Only installed modules found in `modules.json` * [multiqc_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` found and not ignored. * [multiqc_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `report_section_order` * [multiqc_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `export_plots` * [multiqc_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains `report_comment` * [multiqc_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` follows the ordering scheme of the minimally required plugins. * [multiqc_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains a matching 'report_comment'. * [multiqc_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/multiqc_config) - `assets/multiqc_config.yml` contains 'export_plots: true'. * [modules_structure](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_structure) - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL' * [base_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/base_config) - `conf/base.config` found and not ignored. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `conf/modules.config` found and not ignored. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `CAT_FASTQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `FASTP_LENGTH_FILTER` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `INDEX_GENOME` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `CLEAN_FASTA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `UMITOOLS_EXTRACT` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `MIRTRACE_QC` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `EDGER_QC` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `SEQCLUSTER_COLLAPSE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `SAMTOOLS_INDEX` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `NFCORE_SMRNASEQ` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `MIRDEEP2_MAPPER` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `SEQKIT_REPLACE` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `SEQKIT_FQ2FA` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `MIRDEEP2_MIRDEEP2` found in `conf/modules.config` and Nextflow scripts. * [modules_config](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/modules_config) - `MULTIQC` found in `conf/modules.config` and Nextflow scripts. * [nfcore_yml](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nfcore_yml) - Repository type in `.nf-core.yml` is valid: `pipeline` * [nfcore_yml](https://nf-co.re/tools/docs/3.0.2/pipeline_lint_tests/nfcore_yml) - nf-core version in `.nf-core.yml` is set to the latest version: `3.0.2` ### Run details * nf-core/tools version 3.0.2 * Run at `2024-10-13 21:17:40`
apeltzer commented 1 month ago

@nf-core-bot fix linting

atrigila commented 1 month ago

I can't reproduce the error:

CI: image Gitpod: image

apeltzer commented 1 month ago

CI not working now because of the template v.3.0.0 release. I'm afraid we need to merge thta one in too :-(

apeltzer commented 1 month ago

Likely Need to merge in 3.0.1 First and then work on this

apeltzer commented 1 month ago

Mergen in dev with Template Channels so that wie can fix anything remaining here and then push everything to dev. Hopefully that should do the Trick and we‘re there then .)

apeltzer commented 1 month ago

Issue with template will be fixed today with nf-core/tools 3.0.2 —> we should merge that in here directly then.

apeltzer commented 1 month ago

Ok next steps would be merging #474 to this PR's branch. Then merging this one to dev and ultimately then making the release after updating the changelog date appropriately :)

nf-core-bot commented 1 month ago

:warning: Newer version of the nf-core template is available.

Your pipeline is using an old version of the nf-core template: 3.0.1. Please update your pipeline to the latest version.

For more documentation on how to update your pipeline, please see the nf-core documentation and Synchronisation documentation.

apeltzer commented 1 month ago

Ok should be fine to go