error generating insertion

[Esbertrand]

Hello,

i'm trying to generate fatsq files with dwgsim using a mutation txt file. It worked perfecty with dwgsim 1.10 but not anymore with the 1.11. Several indels in my file lead to src/dwgsim.c:760: dwgsim_core: Assertion 0 <= byte_index' failed. or 280000dwgsim: src/dwgsim.c:741: dwgsim_core: Assertion0 <= byte_index' failed.

Here an example of insertion : 1 15439084 - AGGTCTTTTTTTTCTTCTCCCAGCGGC 2

My command : dwgsim -e 0.001-0.01 -E 0.001-0.01 -C ${COVERAGE} -1 100 -2 100 -y 0 -c 0 -r 0 -R 0 -x ${bed} -m ${PROJECTDIR}/test3.txt ${PATHTOREF} ${PROJECTDIR}/'readsimulation'${Toss}

I attached test3.txt file to this message and the problematic insertion is the last mutation of the file.

Any idea?

Thanks in advance.

Bertrand test3.txt

[Esbertrand]

sorry i attached the file without the problematic mutation, this one is the good one test3.txt

[nh13]

I'll need to know a coverage value (${COVERAGE}) and the reference sequence (${PATHTOREF}) that you are using. Thanks for posting the bug report!

[Esbertrand]

coverage 40 and ref human_g1k_v37.fasta

[nh13]

@Esbertrand my apologies for the delay, but you wouldn't have the ${bed} file still would you?

[nh13]

@Esbertrand Looks like I was able to reproduce and I have a pull request. Thanks for reporting!

[Esbertrand]

Hi,

the bed file is attached. test.txt

[nh13]

@Esbertrand I have a fix (see #24). I am going to merge it in. Let me know if there are any issues.