search

nleroy917 / optipyzer

Multi-Species Codon Optimization Engine
https://optipyzer.com
Apache License 2.0
23 stars 5 forks source link

Results are not repeatable #19

Closed SilenWang closed 1 year ago

SilenWang commented 2 years ago

Hi LeRoy, I'm using the container build from provided Dockerfile in this project, and found that the optimization results are not repeatable. for example, I ran optimized.optimmized_ad on protein sequence MVSKGEELFTGV for 3 times, and below are results I got:

ATGGTGAGCAAAGGCGAGGAGCTATTTACAGGCGTGTAA
ATGGTGAGCAAAGGCGAGGAGCTATTTACAGGCGTGTAG
ATGGTGTCTAAAGGCGAGGAACTTTTTACGGGCGTGTAG

Which one is better, or they are approximately the same?

And is there any way to make the results repeatable? like setting random seed for something else...

nleroy917 commented 2 years ago

Hi @SilenWang

Thanks for opening an issue this is a good idea! There is definitely inherent "randomness" in the algorithm. The option to set a seed is a good idea.

@caleighroleck thoughts?