search

nloyfer / wgbs_tools

tools for working with Bisulfite Sequencing data while preserving reads intrinsic dependencies
Other
134 stars 37 forks source link

bam2pat support for nanopore data #48

Open Rodcarlessi opened 1 year ago

Rodcarlessi commented 1 year ago

Hi guys,

Amazing tools!

Are there any plans to include functionality in bam2pat to handle nanopre modbams with MM and ML tags? If not, what could be a good way to convert bams with MM and ML tags into a bam that could be used as input for wgbstools?

Many thanks, Rodrigo

nloyfer commented 1 year ago

Hi, I implemented a beta version of bam2pat that supports ONT bam files (MM, ML). I will upload it soon

Rodcarlessi commented 1 year ago

Great, thank you Netanel, this will be very useful

ekushele commented 1 year ago

@nloyfer Any progress with this?

assafgrw commented 1 year ago

Hi I am also wondering if anyone was successfully able to generate pat files and build an atlas with BAM files generated with ONT data (ML and MN tags)

vinodsinghjnu commented 1 year ago

It seems bam2pat for nanopore data has some problem in recognising "eXtended CIGAR", or CIGARX string. 

8,229,233,213,224,53,229,57,235,252,255,255,115,249,247,185,231,247,57,139,181,235,251,74,126,165,34,254,255,170,186,193,255,255,254,241,235,237,255,255,254,238,225,14,254,238,253,255,66,254,254,247  RG:Z:c969ee83   mc:f:99.5874    mg:f:99.6108    NM:i:72     
[ patter ] [ patter ] Unknown CIGAR character: =                                                                                                                                                      
[ patter ] [ chr9 ] Exception while processing line 798. Line content:                                                                                                                                                                                              
m64101_220704_113609/114427486/ccs      0       chr9    239949  60      8034=1I565=4D2297=      *       0       10900   ATTTCCAGTTATTCACATTAGAAACAGTACACCACTGAATAAATTTATGCATTCATCTTTGCTTACCTCTTTAATGATTCTTCACGATAAATGCTAGAAATAGAACCACAGACTTAAAGGTCTCCATTGATATGTGTGGC
nloyfer commented 11 months ago

wgbstools bam2pat now supports ONT bam files. I tested it on bam files from multiple sources, but I am positive I missed some cases. Please let me know in an issue if you encounter problems

assafgrw commented 9 months ago

Hi Netanel, Only today I had time to try bam2pat with ONT data. I was running the bam2pat commnad with the -np flag and I am afraid that there are still issues. I was testing the output with the vis command and it seems that all sites are recognized as 100% methylated. I verified that on several sited that were fully or partially unmethylated (according to modkit output and to IGV view modification option) am I missing something?

Your help is very much appreciated.

ekushele commented 9 months ago

@assafgrw Update your wgbs_tools with git pull and python setup.py for re-compiling This solved the problem for me

AzlanNI commented 7 months ago

Hello everyone! I am currently using wgbstools bam2pat on my ONT Data. And i just looked into the pat file and the entire count column is 4 ? Does anyone else encounter observations like this ? Its just makes me suspicious that for every read i have exactly 4 reads with the same Methylation pattern. Thanks in advance! Kind regards, Azlan