Variants such as Variant("22", 17668822, "TCTCTACTAAAAATACAAAAAATTAGCCAGGCGTGGTGGCAGGTGCCTGTAGTAC", "CC"); raise an error UnsupportedURLVariantFormat when trying to calculate the consequence type (getAllConsequenceTypesByVariant). That is because it's being classified as an SV because it's above 50bp and there is no calculator for a variant with that type (has to be insertion, deletion, mnv etc). To fix, a variant such as the above can be classified as an mnv (with an upper threshold of 1k bp) and then the MNV concsequenceTypeCalculator will be able to figure out the consequence type.
Variants such as Variant("22", 17668822, "TCTCTACTAAAAATACAAAAAATTAGCCAGGCGTGGTGGCAGGTGCCTGTAGTAC", "CC"); raise an error UnsupportedURLVariantFormat when trying to calculate the consequence type (getAllConsequenceTypesByVariant). That is because it's being classified as an SV because it's above 50bp and there is no calculator for a variant with that type (has to be insertion, deletion, mnv etc). To fix, a variant such as the above can be classified as an mnv (with an upper threshold of 1k bp) and then the MNV concsequenceTypeCalculator will be able to figure out the consequence type.