Peter-J-Freeman
commented
2 years ago I want to change how r. inputs are handled. Here is an example based on this issue
import json
import VariantValidator
vval = VariantValidator.Validator()
variant = 'NM_000484.3:r.2065_2211del' # variant 1
genome_build = 'GRCh38'
select_transcripts = 'all'
transcript_set = 'refseq'
validate = vval.validate(variant, genome_build, select_transcripts, transcript_set)
validation = validate.format_as_dict(with_meta=True)
print(json.dumps(validation, sort_keys=True, indent=4, separators=(',', ': '))){
"NM_000484.3:c.2067_2211+2del": { # r. assumed to be equivalent to the c. so converted then mapped as if it is a c.
"alt_genomic_loci": [],
"annotations": {
"chromosome": "21",
"db_xref": {
"CCDS": "CCDS13576.1",
"ensemblgene": null,
"hgnc": "HGNC:620",
"ncbigene": "351",
"select": false
},
"ensembl_select": false,
"mane_plus_clinical": false,
"mane_select": false,
"map": "21q21.3",
"note": "amyloid beta precursor protein",
"refseq_select": false,
"variant": "1"
},
"gene_ids": {
"ccds_ids": [
"CCDS13577",
"CCDS56211",
"CCDS56212",
"CCDS56213",
"CCDS33523",
"CCDS46638",
"CCDS46639",
"CCDS13576"
],
"ensembl_gene_id": "ENSG00000142192",
"entrez_gene_id": "351",
"hgnc_id": "HGNC:620",
"omim_id": [
"104760"
],
"ucsc_id": "uc002ylz.4"
},
"gene_symbol": "APP",
"genome_context_intronic_sequence": "NC_000021.9(NM_000484.3):c.2067_2211+2del",
"hgvs_lrg_transcript_variant": "",
"hgvs_lrg_variant": "",
"hgvs_predicted_protein_consequence": {
"lrg_slr": "",
"lrg_tlr": "",
"slr": "NP_000475.1:p.?",
"tlr": "NP_000475.1:p.?"
},
"hgvs_refseqgene_variant": "NG_007376.1:g.283955_284101del",
"hgvs_transcript_variant": "NM_000484.3:c.2067_2211+2del",
"primary_assembly_loci": {
"grch37": {
"hgvs_genomic_description": "NC_000021.8:g.27264036_27264182del",
"vcf": {
"alt": "T",
"chr": "21",
"pos": "27264031",
"ref": "TACCTCCACCACACCATGATGAATGGATGTGTACTGTTTCTTCTTCAGCATCACCAAGGTGATGACGATCACTGTCGCTATGACAACACCGCCCACCATGAGTCCAATGATTGCACCTTTGTTTGAACCCACATCTTCTGCAAAGAAC"
}
},
"grch38": {
"hgvs_genomic_description": "NC_000021.9:g.25891724_25891870del",
"vcf": {
"alt": "T",
"chr": "21",
"pos": "25891719",
"ref": "TACCTCCACCACACCATGATGAATGGATGTGTACTGTTTCTTCTTCAGCATCACCAAGGTGATGACGATCACTGTCGCTATGACAACACCGCCCACCATGAGTCCAATGATTGCACCTTTGTTTGAACCCACATCTTCTGCAAAGAAC"
}
},
"hg19": {
"hgvs_genomic_description": "NC_000021.8:g.27264036_27264182del",
"vcf": {
"alt": "T",
"chr": "chr21",
"pos": "27264031",
"ref": "TACCTCCACCACACCATGATGAATGGATGTGTACTGTTTCTTCTTCAGCATCACCAAGGTGATGACGATCACTGTCGCTATGACAACACCGCCCACCATGAGTCCAATGATTGCACCTTTGTTTGAACCCACATCTTCTGCAAAGAAC"
}
},
"hg38": {
"hgvs_genomic_description": "NC_000021.9:g.25891724_25891870del",
"vcf": {
"alt": "T",
"chr": "chr21",
"pos": "25891719",
"ref": "TACCTCCACCACACCATGATGAATGGATGTGTACTGTTTCTTCTTCAGCATCACCAAGGTGATGACGATCACTGTCGCTATGACAACACCGCCCACCATGAGTCCAATGATTGCACCTTTGTTTGAACCCACATCTTCTGCAAAGAAC"
}
}
},
"reference_sequence_records": {
"protein": "https://www.ncbi.nlm.nih.gov/nuccore/NP_000475.1",
"refseqgene": "https://www.ncbi.nlm.nih.gov/nuccore/NG_007376.1",
"transcript": "https://www.ncbi.nlm.nih.gov/nuccore/NM_000484.3"
},
"refseqgene_context_intronic_sequence": "NG_007376.1(NM_000484.3):c.2067_2211+2del",
"selected_assembly": "GRCh38",
"submitted_variant": "NM_000484.3:r.2065_2211del",
"transcript_description": "Homo sapiens amyloid beta precursor protein (APP), transcript variant 1, mRNA",
"validation_warnings": [
"NM_000484.3:r.2065_2211del automapped to NM_000484.3:c.2065_2211del",
"NM_000484.3:c.2065_2211del normalized to NM_000484.3:c.2067_2211+2del",
"A more recent version of the selected reference sequence NM_000484.3 is available (NM_000484.4): NM_000484.4:c.2067_2211+2del MUST be fully validated prior to use in reports: select_variants=NM_000484.4:c.2067_2211+2del"
],
"variant_exonic_positions": {
"NC_000021.8": {
"end_exon": "17i",
"start_exon": "17"
},
"NC_000021.9": {
"end_exon": "17i",
"start_exon": "17"
},
"NG_007376.1": {
"end_exon": "17i",
"start_exon": "17"
}
}
},
"flag": "gene_variant",
"metadata": {
"variantvalidator_hgvs_version": "2.0.2.dev1+g6ecbf8e",
"variantvalidator_version": "1.0.5.dev288+g3cf22ee",
"vvdb_version": "vvdb_2022_04",
"vvseqrepo_db": "VV_SR_2022_02/master",
"vvta_version": "vvta_2022_02"
}
}
ifokkema
DCRT-LUMC
leicray
User Story Hi VariantValidator team, we got into some problems this morning using your tool and are trying to understand what is going wrong. We wanted to look at the consequence of deleting a whole exon from the APP gene and typed in the following: NM_000484.4:c.2065_2211del. Variant validator then corrects this somehow to: NM_000484.4:c.2065_2211del normalized to NM_000484.4:c.2067_2211+2del --> which is obviously not a whole exon but part of the intron. Checking with Mutalyzer gave us the correct output though. Since we use the VariantValidator API for a tool of ours, we are a bit worried what is happening here. Could you please have a look? I also checked the genome browser etc and there our initial description is correct, I do not understand why VV changes it.
What we are doing is developing a tool to prioritze patients for tailormade genetic therapies and need to predict what happens if we delete single exons, i.e. will we create a termination codon etc. So happy to work together on this. We are fully aware that we need to have the HGVS nomenclature correct, so we are not trying to give a wrong description, we really need to see what happens to the AA sequence when we take single exons out.
Describe the solution you'd like Tools like VV and Mutalyzer are not intended to predict the consequences of variations beyond the scope of direct mapping of variation at the DNA level to its correct position with respect to HGVS guidelines then interpret the outcome. You should not use non-compliant descriptions because they are more convenient so I recommend against using NC_000021.9(NM_000484.3):c.2065_2211del because it will not be accepted by clinical journals going forward, nor will it be accepted by databases such as ClinVar and LOVD. Correct nomenclature must be used and will in the very near future be enforced. Happy to discuss what you intend to do, and look at options, but remember NC_000021.9(NM_000484.3):c.2065_2211del is exactly the same as NC_000021.9(NM_000484.4):c.2067_2211+2del, but only the latter is correctly described. What exactly do you want to achieve? For example, if you are trying to describe a known deletion at the RNA level, i.e. you know the sequence of the RNA, the correct description would be NM_000484.3:r.2065_2211del (not c.) and this could be translated into a protein. It would make sense for us to implement a method that would accurately apply HGVS r. rules to make sure NM_000484.3:r.2065_2211del is indeed correctly described, whether it needs to be shuffled internally within the RNA sequence and what the protein outcome would be.
Additional context Guidance that r. descriptions will not necessarily directly map to a g. c. description and must be used in conjunction with correct c. and r. descriptions.