Closed oschwengers closed 8 months ago
For some reasons, Pilcer-CR does not include the array's last spacer in the position of the entire array:
contig_1 PILER-CR CRISPR 20141 20306 . ? . ID=AAAAAAAAAA_1;Name=CRISPR array with 3 repeats of length 22, consensus sequence CGGGGCTGAAGGAACTGGCCGC and spacer length 50;product=CRISPR array with 3 repeats of length 22, consensus sequence CGGGGCTGAAGGAACTGGCCGC and spacer length 50 contig_1 PILER-CR crispr-repeat 20141 20162 . ? . ID=AAAAAAAAAA_1_repeat_1 contig_1 PILER-CR crispr-spacer 20163 20212 . ? . ID=AAAAAAAAAA_1_spacer_1;sequence=ACTCGGGGGCCTGAAGGAACTGGACCTTTCCGCCACCAAGGTCACTGATG contig_1 PILER-CR crispr-repeat 20213 20234 . ? . ID=AAAAAAAAAA_1_repeat_2 contig_1 PILER-CR crispr-spacer 20235 20284 . ? . ID=AAAAAAAAAA_1_spacer_2;sequence=CCTCCGGGACCTGCAGACGTTGAACCTCCACGGCACGAGGCTGACAGGGA contig_1 PILER-CR crispr-repeat 20285 20306 . ? . ID=AAAAAAAAAA_1_repeat_3 contig_1 PILER-CR crispr-spacer 20307 20356 . ? . ID=AAAAAAAAAA_1_spacer_3;sequence=GCTGCATGACTTGCGAGAACTGGACCTCTCCATGAGCGACGTGACGGACG
For some reasons, Pilcer-CR does not include the array's last spacer in the position of the entire array: