search

oushujun / EDTA

Extensive de-novo TE Annotator
https://genomebiology.biomedcentral.com/articles/10.1186/s13059-019-1905-y
GNU General Public License v3.0
336 stars 73 forks source link

Question about MITEs #381

Closed tongyin121 closed 6 months ago

tongyin121 commented 1 year ago

Hello, during the use of EDTA, I found that many MITE transposons are enriched in certain regions of the genome and belong to the same TE family (TE_00001032#MITE/DTM). The sequence is TTGCCTTTGAATTTCGGGTGATCTCTCTTGAGCATGTATGCTTCTGCTACTTGTTCTACATCAGACTTCTTCCGCAAACGGCGAAACGCTTTGACTCGGTGAGTTTCGCGGCATTCCGACTTCGATGCCCCAAATTACC. I would like to ask how to verify the validity and accuracy of the annotation results?

oushujun commented 1 year ago

Hello, you need to manually curate it. For example, extract the sequence with extension to its flanking for a certain distance, ie. 1000bp, then blast your genome and see if the alignment is only on your candidate TE or extends further out.