oushujun
commented
8 months ago Try not to use number only sequence names. Your two files do not follow the FASTA format conventions, which require each sequence ID starts with “>”
Shujun
On Sat, Oct 7, 2023 at 2:09 PM xiaomifeng12 @.***> wrote:
Dear @oushujun https://github.com/oushujun Many thanks for developing this very useful tool. Some errors occurred while using EDTA software
I installed the EDTA software using Conda and ran the data in test using the EDTA command, and everything went smoothly. conda activate EDTA Usage: EDTA.pl --genome test.genome.fa --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.6e-8 --curatedlib ~/db/sine_line.fa --overwrite 1
But when using the same EDTA command to run my data, some errors will be reported. conda activate EDTA Usage: EDTA.pl --genome genome.fa --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.6e-8 --curatedlib ~/db/sine_line.fa --overwrite 1
error1: Species: others Traceback (most recent call last): File "/public/home/dd/miniconda3/envs/EDTA/share/EDTA/bin/TIR-Learner2.5/Module2/RunGRF.py", line 79, in if (len(str(records[0].seq))>int(length)+500): IndexError: list index out of range cp: cannot stat 'TIR-Learner/-p': No such file or directorycat: '-+-DTA.fa': No such file or directory cat: '-+-DTC.fa': No such file or directorycat: '-+-DTH.fa': No such file or directory cat: '-+-DTM.fa': No such file or directorycat: '-+-DTT.fa': No such file or directory cat: '-+-NonTIR.fa': No such file or directorycat: '-+--+-.gff3': No such file or directory rm: cannot remove '-+--+-*.gff3': No such file or directory Traceback (most recent call last):
error2: Species: others Warning: LOC list Cjam.genome.fasta.mod.TIR.ext30.list is empty. Error: Error while loading sequenceWarning: The TIR result file has 0 bp! Sun Oct 8 00:01:27 CST 2023 Start to find Helitron candidates. Sun Oct 8 00:01:27 CST 2023 Identify Helitron candidates from scratch. Warning: LOC list Cjam.genome.fasta.mod.HelitronScanner.raw.ext.list is empty. Warning: LOC list Cjam.genome.fasta.mod.HelitronScanner.raw.ext.list is empty. Error: Error while loading sequence perl make_bed_with_intact.pl EDTA.intact.fa > EDTA.intact.bed
This is my file1 format
010000002.1 aatcctcttactaatgtatttatcttcaaaataagctatcacatgtagctatagtcatag atttgagggaggagaagattttcttagacgcgtaccccaaaaaccgcgtaagttcacaaa aaatcagttttttcgaaatagcaacaaatctattgttccggcagaaaaaaggccgtcaac cttttcgatggggaatgtttttgcgcacattttggtgaaaatgttgtgaaaatatcttga
This is my file2 format
Chr5 TAAAATACCTAACATGCTTTAAGTTTTCAATATTTCGTTGAAATTAATCAAGTTTCTTAT TTTTATTTTTGCAACTTAATTTGATACATGTTTTGATAAGTTTTGAAAACGAAGTTTAAA TAATTAATATGGAATTTTTCCTTTCTGCCAAATAATGTGGGTATGTCAACGAAACCCTAT GACAGAACTCATAACCGTCAGTTTGACAGGCGGTATAAGTCTCTCCACTGACATCCACTT AAATGTTTGATATGGTTTTTGTAGTAGTCCATTGTGGAAAAAATATTTATTTCCTCTTTG ACCATTTTTTTCTACAGGTATAACTCATGTAAACTTTAACAAAACAAATACTTGCTTCGT GTTTGGTATCGTTTTAGTATTCCTCCAGTCAGCTCAGCCATGTCTGATTCTGTTAGCGTT CTGATTCTGTTAGTATTGTCATTTTGCGAATGCAGTGAGATTTGGAGACGGTTAAACTCA GTATCGATAAGAATATTATATTTCCCGGAAAGAACATATTTGAGAAAGACGGAAATTTCA GACTGCTTTTCTGTGCCAAAAGGTGTCTCCAGCACAAGGACTGTTCGTTCATCACACGAA ACCGGGAATGTCGAGGATTCGGTAACTCGGAAGGAATTGAAATATATATGCTATATCTTT
I have tried various parameters, but still cannot run EDTA normally. I hope you can help solve it. Thank you very much!
— Reply to this email directly, view it on GitHub https://github.com/oushujun/EDTA/issues/393, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABNX4NBDZFXQCPDSHI2XDC3X6GLD7AVCNFSM6AAAAAA5XCSVIOVHI2DSMVQWIX3LMV43ASLTON2WKOZRHEZTCNBUHA3DINQ . You are receiving this because you were mentioned.Message ID: @.***>
xiaomifeng12
Dear @oushujun Many thanks for developing this very useful tool. Some errors occurred while using EDTA software
I installed the EDTA software using Conda and ran the data in test using the EDTA command, and everything went smoothly. conda activate EDTA Usage: EDTA.pl --genome test.genome.fa --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.6e-8 --curatedlib ~/db/sine_line.fa --overwrite 1
But when using the same EDTA command to run my data, some errors will be reported. conda activate EDTA Usage: EDTA.pl --genome genome.fa --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.6e-8 --curatedlib ~/db/sine_line.fa --overwrite 1
error1: Species: others Traceback (most recent call last): File "/public/home/dd/miniconda3/envs/EDTA/share/EDTA/bin/TIR-Learner2.5/Module2/RunGRF.py", line 79, in
if (len(str(records[0].seq))>int(length)+500):
IndexError: list index out of range
cp: cannot stat 'TIR-Learner/-p': No such file or directorycat: '-+-DTA.fa': No such file or directory
cat: '-+-DTC.fa': No such file or directorycat: '-+-DTH.fa': No such file or directory
cat: '-+-DTM.fa': No such file or directorycat: '-+-DTT.fa': No such file or directory
cat: '-+-NonTIR.fa': No such file or directorycat: '-+--+-.gff3': No such file or directory
rm: cannot remove '-+--+-*.gff3': No such file or directory
Traceback (most recent call last):
error2: Species: others Warning: LOC list Cjam.genome.fasta.mod.TIR.ext30.list is empty. Error: Error while loading sequenceWarning: The TIR result file has 0 bp! Sun Oct 8 00:01:27 CST 2023 Start to find Helitron candidates. Sun Oct 8 00:01:27 CST 2023 Identify Helitron candidates from scratch. Warning: LOC list Cjam.genome.fasta.mod.HelitronScanner.raw.ext.list is empty. Warning: LOC list Cjam.genome.fasta.mod.HelitronScanner.raw.ext.list is empty. Error: Error while loading sequence perl make_bed_with_intact.pl EDTA.intact.fa > EDTA.intact.bed
This is my file1 format
This is my file2 format
I have tried various parameters, but still cannot run EDTA normally. I hope you can help solve it. Thank you very much!