search

pblischak / HyDe

Hybridization detection using phylogenetic invariants
http://hybridization-detection.readthedocs.io
MIT License
41 stars 14 forks source link

Exception KeyError #4

Closed stsmall closed 6 years ago

stsmall commented 6 years ago

Hi, I keep getting an error when running HyDe. It is definitely something with my input files as I do not return the same error when I run on the snake data in examples. The online docs mention phylip format, does this include relaxed format? If not then likely that the name length is my issue. thanks,

head input.phy funestus4590C5Kenya ATTATCGGTCGCTTACTGCTAGCAAATTCCTGCACCGATTTATGCCAGCATACCACGAGAAAATACGCCATTTCCTAATG funestuscfMALAF1057SouthAfrica ATTATCGGTCGCTTACTGCTAGCAAATTCCTGCACCGATTTATGCCAGCATACCACGAGAAAATACGCC funestuscfMALAF10711Kwa ATTATCGGTCGCTTACTGCTAGCAAATTCCTGCACCGATTTATGCCAGCATACCACGAGAAAATACGCCATTTCCT funestuscfMALAF994SouthAfrica ATTATCGGTCGCTTACTGCTAGCAAATTCCTGCACCGATTTATGCCAGCATACCACGAGAAAATACGCCA funestuscfMALF90Kwa ATTATCGGTCGCTTACTGCTAGCAAATTCCTGCACCGATTTATGCCAGCATACCACGAGAAAATACGCCATTTCCTAATG funestuscfMALF982SouthAfrica ATTATCGGTCGCTTACTGCTAGCAAATTCCTGCACCGATTTATGCCAGCATACCACGAGAAAATACGCCAT funestusF220Moz ATTATCGGTCGCTTACTGCTAGCAAATTCCTGCACCGATTTATGCCAGCATACCACGAGAAAATACGCCATTTCCTAATGCTTT funestusGhaF264Ghana ATTATCGGTCGCTTACTGCTAGCAAATTCCTGCACCGATTTATGCCAGCATACCACGAGAAAATACGCCATTTCCTAAT funestusGhaF265Ghana ATTATCGGTCGCTTACTGCTAGCAAATTCCTGCACCGATTTATGCCAGCATACCACGAGAAAATACGCCATTTCCTAAT funestusMozF123Mozambique ATTATCGGTCGCTTACTGCTAGCAAATTCCTGCACCGATTTATGCCAGCATACCACGAGAAAATACGCCATTTC

head map.txt funestus4590C5Kenya FUN funestuscfMALAF1057SouthAfrica LIK funestuscfMALAF10711Kwa LIK funestuscfMALAF994SouthAfrica LIK funestuscfMALF90Kwa LIK funestuscfMALF982SouthAfrica LIK funestusF220Moz FUN funestusGhaF264Ghana FUN funestusGhaF265Ghana FUN funestusMozF123Mozambique FUN

Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored Reading input file.Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Exception KeyError: ('c',) in 'phyde.core.data.HydeData._convert' ignored .Done.

pblischak commented 6 years ago

Hi Scott,

Are the sequence names and the sequence data on separate lines for each sample for the input.phy file? Also, it looks like the populations that your samples belong to are not all listed together. So, for your data, you would need to have all of the FUN samples listed next to one another, then the LIK samples, etc. On top of this, the sequences in the input.phy file need to be in the same order as in the map file. Please let me know if that works

stsmall commented 6 years ago

The samples are in the same order between the map and infile.phy, I regrouped the POP names so they are in blocks as well. Unfortunately neither of those things resolved the error. I also tried to shorten the names but that didnt work either. The samples and sequence are on the same line, I am not sure why it looks like that in the comment. Any ideas on what I should try? thanks!!

stsmall commented 6 years ago

The lowercase patch fixed it. Now on to make sense of the output! Thank you!