search

phac-nml / staramr

Scans genome contigs against the ResFinder, PlasmidFinder, and PointFinder databases.
Apache License 2.0
113 stars 26 forks source link

Add support for enterococcus faecium #56

Closed mjram0s closed 5 years ago

mjram0s commented 5 years ago

This looks amazing. Thanks so much @mjram0s

In addition to the comments below, I noticed something else. When we were looking through one of the papers (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4249377/) there was a strain of Enterococcus faecium referenced (C68) which included the insertion of S at position 466 for pbp5.

The assembled version of this genome is available at ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/001/543/825/GCF_001543825.1_ASM154382v1/GCF_001543825.1_ASM154382v1_genomic.fna.gz.

When I run this through staramr, I don't pick up the insertion at position 466 in gene pbp5 though (I only get gyrA (E87G) and parC (S80I)).

Could you maybe spend some time looking into why we aren't picking this up? I believe this was the model we used to create the pbp5 for the integration tests. So, maybe you could run blast of this genome against pbp5 and make sure that the inserted nucleotides are the same as the ones we're using for the integration test? I believe this was something like:

Query  1381   CAAGTAACTCGTGT---TAGTGATGTGTCACAAGTAGACTTAAAAACTGCTTTGATTTAT  1437
              |||||||| |||||   ||||||||| ||||||||||||||||||||||||||||| |||
Sbjct  42311  CAAGTAACGCGTGTCAGTAGTGATGTATCACAAGTAGACTTAAAAACTGCTTTGATCTAT  42252

I hope this makes sense?

The insertion at 466 is detected when pid-threshold is lowered (I tested with 80).

apetkau commented 5 years ago

Awesome. Thanks so much for all your hard work @mjram0s :heart:. I'm merging this in.