Rubric really slow to render Text with TextBackgroundColor

[hernanmd]

Context: I want to visualize DNA sequence alignments in Pharo 8. For this task most bioinformatics applications set a background color for each letter. But in Pharo the Inspector is too slow to open even for just one small sequence of 1Kb.

Have a look at this script which takes about 6 seconds to open an Inspector. The script uses BioSmalltalk, and the code could be enhanced for sure, but that is not relevant to my performance problem of visualization and it could be replicated without the Bio classes:

[
| text attributes |
" Generate a Text object from a random sequence "
text := ((BioSequence forAlphabet: BioDNAAlphabet) randomLength: 1000) sequence asText.
" Setup an array for each nucleotide background color "
attributes := Array new: text size.
1 to: text size do: [ : index |
attributes at: index put: {
(TextBackgroundColor color: (BioDNAAlphabet colorMap at: (text at: index))) }  ].
text runs: (RunArray newFrom: attributes).
text inspect
] timeToRun asString  "'0:00:00:05.911'"

Also, resizing the opened Inspector takes 2-3 seconds to refresh. You can see the output here: https://imgur.com/a/xUlBeVY

I should say without the #inspect the code ran without performance issues: "'0:00:00:00.009'"

So I ran again the script for different sequence sizes:

String streamContents: [ : stream |
100 to: 2000 by: 100 do: [ : sl |
stream nextPutAll: ([
| text attributes |
" Generate a Text object from a random sequence "
text := ((BioSequence forAlphabet: BioDNAAlphabet) randomLength: sl) sequence asText.
" Setup an array for each nucleotide background color "
attributes := Array new: text size.
1 to: text size do: [ : index |
  attributes at: index put: {
    (TextBackgroundColor color: (BioDNAAlphabet colorMap at: (text at: index))) }  ].
  text runs: (RunArray newFrom: attributes).
  text inspect ] timeToRun asString);
  cr
  ]
]

And these are the results:

0:00:00:00.147 0:00:00:00.28 0:00:00:00.568 0:00:00:00.993 0:00:00:01.776 0:00:00:02.123 0:00:00:03.111 0:00:00:04.084 0:00:00:04.574 0:00:00:06.192 0:00:00:07.214 0:00:00:07.915 0:00:00:10.382 0:00:00:12.725 0:00:00:12.359 0:00:00:17.357 0:00:00:17.147 0:00:00:20.651 0:00:00:20.392 0:00:00:23.238

At first I thought it was a problem of the Glamout text renderer for Rubric Text, but profiling a single pass of the snippet for 2000 letters, shows a couple of methods in Rubric scanner, after some DNU sends, which are consuming a lot of the time: RubCharacterBlockScanner(RubCharacterBlockScanner) >> characterBlockAtPoint:index:in: and RubCharacterBlockScanner(RubCharacterBlockScanner) >> endOfRun Profile_DNABgColoring.txt ". I attached the full profiler report so you may have a look if you like. But the summary is:

Leaves 37.4% {8800ms} RubCompositionScanner(RubCharacterScanner)>>basicScanCharactersFrom:to:in:rightX:stopConditions:kern: 6.3% {1476ms} Dictionary>>at:ifAbsentPut: 6.1% {1425ms} Context>>unwindComplete 4.6% {1082ms} Semaphore>>criticalReleasingOnError: 4.2% {991ms} Dictionary>>at:ifAbsent: 3.3% {785ms} Context>>aboutToReturn:through: 2.2% {527ms} Context>>resume:through: 2.0% {470ms} ExternalAddress>>isNull 1.8% {421ms} BlockClosure>>on:do: 1.7% {402ms} RubCharacterBlockScanner(RubCharacterScanner)>>setConditionArray: 1.6% {378ms} FreeTypeFace>>validate 1.6% {376ms} Dictionary>>scanFor: 1.5% {364ms} Context>>unwindComplete: 1.5% {344ms} Context>>unwindBlock 1.4% {323ms} Array(SequenceableCollection)>>do: 1.3% {299ms} Dictionary(HashedCollection)>>findElementOrNil: 1.2% {293ms} RunArray>>at:setRunOffsetAndValue: 1.2% {289ms} FreeTypeCache>>atFont:charCode:type:ifAbsentPut: 1.1% {252ms} FreeTypeCacheLinkedList>>moveDown:

Memory old +0 bytes young -1,485,272 bytes used -1,485,272 bytes free +1,485,272 bytes

GCs full 0 totalling 0ms (0.0% uptime) incr 947 totalling 1,576ms (7.0% uptime), avg 2.0ms tenures 0 root table 0 overflows

[welcome[bot]]

Thanks for opening your first issue! Please check the CONTRIBUTING documents for some tips about which information should be provided. You can find information of how to do a Pull Request here: https://github.com/pharo-project/pharo/wiki/Contribute-a-fix-to-Pharo

GitHub

pharo-project/pharo

Pharo is a dynamic reflective pure object-oriented language supporting live programming inspired by Smalltalk. - pharo-project/pharo

[bencoman]

Hi Hernan,

Are you able to decouple your example from your application? To make it quicker for people to tune in to the problem. That is, provide a script to create a class with the SampleData with some test data....

Object subclass: #SampleData
    instanceVariableNames: ''
    classVariableNames: ''
    package: ''

SampleData compile: 'colorMap
   "extracted application code"

[hernanmd]

Ok, I decoupled the script from my app, using the example of a random sequence of 2000 letters. Don't foget to try also without the "inspect" to see the time difference.

| text attributes colorMap |        
text := 'TTTAAATGAACCTCCTATCTTCAACTAGGTTTCCAAATTTCGCCCGAGGAGACATTGTTAGGGGAGTCACCGGCACTTAATCACGCCTAAATAGATAAACATCAGCGTGCATAGTCCAGGTGACTTTGTGCACAAGGGTTCTTTAAGTTCATAGTAAGTCGGGTCCTGTCGAAGCAAAAGACAAGGGCTCCAGCACCCCAGAACCATTATGACAGAGGATACACACGGGTTTCAAAGTTGAGTGAGTGTTGAATTTCTAGTGTGGGCAAGTATACTGCCTTAGTTTTATTCCAGTGCGTGCATCAACCCGGGCCTGCTCTGGCGAAGGCTACATATGTATTACGAGGTAGGTGAGTAACCTATAGTTGATCCATCTTGGACTGGCACATTTCCGCCCCGTCCATGACGTGGTACGCAGAAGGATTTAGCCTTAGAAAAATAGCCCACCGAGAGGGCCTCTCCCGTTCCTCGGAATTGGACCTGCCGAACACGGCCGCTTAATGGATCAACCGCGTCGTGCAGTAGTTTTACCCATCACCAAGGTTCAACTCCCTTTGACGTGGTTACTGGCGGGACAGAACAGCTGCAAATGCCCCCAGAGGAAGTGTTTCGATGCATATCACGGAATATAAGGACTTTGTACTTAGACGAGCCAACGGTGGTGCATCAAACAGCACGTGTACACAAACGTCTTAGTATTCATAGCAGCTTTAAGACGGTTATATACTGACGGTATGTAAACAGCAAATAGCCTCAACCGTTTTACATCTGACCTTACAGCTTCCAGTAGTCGTGTTAAATAAGGAAACCCATGTTTGTCCCCACAGACGCGGGAGCTGGGCAAATTCCGTGACTATTCTGAAGAGGTGGCGTGAACTGTGGCGGTGCACTTTGGACTCCGAGTACATCGGTTAGGCGTCACTCAAAGAGCCGAACTGGTCTAGCAGAATCAAGGGATATAAGGCGTGACTCCTTGGCGCTTTAGGTGGAAACAGAGGCCAGCACTTGCACCTACTACAACGCCTTTCACTTACACCTCTCGCCCCGTCTATCGTACCGATCAATGCGTTGCGGTCCTTCTCATAACTCGTGGAGATGAGCTATTTTTTCCATAGAGTTCCTGGCGTACTAGACTGCGAGAATCCCAGTCCAAGGAGCCATTCTCAACCTGTGTATGTGTGGTACCGTCCAGGTGGGATCGCTGCGTCCCGGTCACGTAGTGGCGAGGACGAGTTTCTTATTACAGGTGTATAAGCCATACGGCGCCAAGAGTATGAGGGATCATCTCCGCCTGCAGGAGCGTAGACATAAGCGGGTTTGGCACGTACATATTAAGATGGGGCAACTACCTATAGAGTTATGTATTACCACCGTTAGACTCTCAAACGACCAGTCCTCTATCGCCGACTATCGCACAGTGGAACTGACTGGAATTCGTGAGCAGCGTCGGCTATGCCCGTCCGGACGGTGAGCTATAGCATCTAAATCGACGATATTAGGCCAGCCGGGTTTTTGATGGTGCGCCGTCAACTTGCGGATGAGGCGAGGGACGGGATGTGGGGGACCGCAACAAGATTCGTTTCCCAGTCCACCTTGCGTTTCCTGCTGTAGGACCGTCCCCTTGTGGGAAGATAGGATAACGACTGGAACGCAACGTCCCGGCTGAGCGAACTAGTCGCGTGGCACGTTGGATCTAGGCGGGTACGCACAAGGACCGATACGACCCCCGGGTGATCGGGCCCGATACGTTCGCACGAATGACTCGTCCGGACATCTGTACGCTAGGTATGAACGGCTTCAACCGCATTGTATCAACATTAGTTCGCCATATTGAGGTCTTTCGTTGGACAATAGTGCGTTATCCCAAATCAGACAGAAACAACGTACGGCGAAAACGCAATCGAATACGCACGAATATTTGACAGTAACTCCATTCCAGGTGGTATACAGTACATAAGCGCGGCATCCCGTAAGATGACCCAGAACTTCCTTAACAGGCA' asText.
colorMap := Dictionary new
    add: ($T->(Color r: 0.7996089931573802 g: 1.0 b: 1.0 alpha: 1.0)); 
    add: ($G->(Color r: 0.3998044965786901 g: 1.0 b: 1.0 alpha: 1.0)); 
    add: ($A->(Color r: 1.0 g: 1.0 b: 0.7996089931573802 alpha: 1.0)); 
    add: ($C->(Color r: 0.7996089931573802 g: 1.0 b: 0.6001955034213099 alpha: 1.0)); 
    yourself.
" Setup an array for each nucleotide background color "
attributes := Array new: text size.
1 to: text size do: [ : index |
    attributes at: index put: { 
        (TextBackgroundColor color: (colorMap at: (text at: index))) } ].
text runs: (RunArray newFrom: attributes).
text inspect.

[kasperosterbye]

It might be due to the method RubAbstractTextArea>>markBackgroundColors. Background colors are done using segments, which is in essence a dedicated morph. Not scalable at all. I believe I was the person responsible for this method originally, and at the time I was more than happy to find any way at all to do background colors on text.