CRISPRessoBatch for Prime Editing

[tracie-mg]

Hello,

I'm having issues while running CRISPRessoBatch for prime editing experiments. I've double checked my pegRNA spacer, pegRNA extension and the reference sequence, all are in the correct orientation as specified by:

--prime_editing_pegRNA_spacer_seq: pegRNA spacer sgRNA sequence used in prime editing. The spacer should not include the PAM sequence. The sequence should be given in the RNA 5'->3' order, so for Cas9, the PAM would be on the right side of the given sequence. (default: )

--prime_editing_pegRNA_extension_seq: Extension sequence used in prime editing. The sequence should be given in the RNA 5'->3' order, such that the sequence starts with the RT template including the edit, followed by the Primer-binding site (PBS). (default: )

My pegRNA spacer can be found in the reference sequence, while the extension seq is the reverse complement

However, I'm still running into this error

[Command used]:
/usr/local/bin/CRISPResso -o /tmp/nxf.XXXXNwuG6i/CRISPRessoBatch_on_1 --name 230825_KDB_AE_P2E11_160_4_33_71_2n_WT --exclude_bp_from_right 15 --fastq_r1 230825-KDB-AE-P2E11-160-4-33-71-2n-WT_S181_L001_R1_001.fastq.gz --prime_editing_pegRNA_scaffold_min_match_length 1 --aln_seed_min 2 --default_min_aln_score 60 --quantification_window_size 1 --conversion_nuc_to T --min_average_read_quality 0 --amplicon_name Reference --prime_editing_pegRNA_scaffold_seq GTTTGAGAGTGAGAAATCACGAGTTCAAAAAACATGATTTATTCAAACCGTCTTCTTCGGAAGGCCCCACAGTGTGTGG --max_rows_alleles_around_cut_to_plot 50 --needleman_wunsch_gap_incentive 1 --trimmomatic_command trimmomatic --conversion_nuc_from C --min_single_bp_quality 0 --prime_editing_pegRNA_extension_quantification_window_size 5 --plot_window_size 20 --max_paired_end_reads_overlap 100 --aln_seed_len 10 --fastq_r2 230825-KDB-AE-P2E11-160-4-33-71-2n-WT_S181_L001_R2_001.fastq.gz --exclude_bp_from_left 15 --amplicon_seq ACTGCTTCTCCTCTTGGGAAGTGTAAGGAAGCTGCAGCACCAGGATCAGTGAAACGCACCAGACGGCCGCGTCAGAGCAGCTCAGGTTCTGGGAGAGGGTAGCGCAGGGTGGCCACTGAGAACCGGGCAGGTCACGCATCCCCCCCTTCCCTCCCACCCCCTGCCAAGCTCTCCCTCCCAGGATCCTCTCTGGCTCCATCGTAAGCAAACCTTAGAGGTTCTGGCAAGGAGAGAGATGGCTCCAGGAAAT --needleman_wunsch_gap_open -20 --verbosity 3 --min_paired_end_reads_overlap 10 --flash_command flash --min_bp_quality_or_N 0 --flexiguide_homology 80 --prime_editing_pegRNA_spacer_seq TCTGGGAGAGGGTAGCGCAGGGTG --n_processes 1 --min_frequency_alleles_around_cut_to_plot 0.2 --aln_seed_count 5 --prime_editing_pegRNA_extension_seq TGCCCGGTTCTCAGTGTAGCGCCTGCGCTACCCT --needleman_wunsch_gap_extend -2 --needleman_wunsch_aln_matrix_loc EDNAFULL --quantification_window_center -3

[Execution log]:
Traceback (most recent call last):
  File "/usr/local/lib/python3.10/site-packages/CRISPResso2/CRISPRessoCORE.py", line 1373, in main
    raise CRISPRessoShared.BadParameterException("The pegRNA spacer aligns to the pegRNA extension sequence in 3'->5' direction. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5'->3' order, and the pegRNA extension sequence (--prime_editing_pegRNA_extension_seq) must be given in the 5'->3' order. In other words, the pegRNA spacer sequence should be found in the given reference sequence, and the reverse complement of the pegRNA extension sequence should be found in the reference sequence.")
CRISPResso2.CRISPRessoShared.BadParameterException: The pegRNA spacer aligns to the pegRNA extension sequence in 3'->5' direction. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5'->3' order, and the pegRNA extension sequence (--prime_editing_pegRNA_extension_seq) must be given in the 5'->3' order. In other words, the pegRNA spacer sequence should be found in the given reference sequence, and the reverse complement of the pegRNA extension sequence should be found in the reference sequence.

Parameter error, please check your input.

ERROR: The pegRNA spacer aligns to the pegRNA extension sequence in 3'->5' direction. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5'->3' order, and the pegRNA extension sequence (--prime_editing_pegRNA_extension_seq) must be given in the 5'->3' order. In other words, the pegRNA spacer sequence should be found in the given reference sequence, and the reverse complement of the pegRNA extension sequence should be found in the reference sequence.

I've found that when I rerun the program, sometimes it runs to completion without error while other times, it'll run into this error despite me not changing the sequence. Can you help me troubleshoot this? Thank you!

[Colelyman]

Hi @tracie-mg,

Thanks for using CRISPResso and sorry to hear that you are running into these issues. A few questions:

1. What version of CRISPResso2 are you using? If you are not on the latest version (v2.2.14), please update and try again.
2. Are you comfortable sharing your data (or a subset) so that we can try and troubleshoot? If you don't want to share it publicly you can email me at cole@edilytics.com

Thank you, Cole

[kclem]

Hi @tracie-mg,

CRISPResso performs several checks to make sure the pegRNA components (e.g. spacer, extension seqs) are in the correct orientation. In your case, the alignment score indicated that the spacer might be provided in the incorrect orientation (you can see these alignments if you run a CRISPResso command with the --debug flag):

pegRNA spacer vs extension_seq alignment:
Forward (correct orientation):
TCTGGGAGAGGGTAGCGCAGGGTG------------------
--------AGGGTAGCGCAGGCGCTACACTGAGAACCGGGCA
Score: 30.952

Reverse (incorrect orientation):
--------TCTGGGAGAGGGTAGCGCAGGGTG---------
TGCCCGGTTCTC----AGTGTAGCGCC---TGCGCTACCCT
Score: 34.146

To override these checks (if you're sure you are providing the input in the correct orientation) please run with the parameter --prime_editing_override_sequence_checks and it won't perform these checks.

For the future, we've added additional parameters so you can control how your pegRNA components align (#336).

Let me know if that helps!

[tracie-mg]

Thank you! I ended up using the --prime_editing_override_sequence_check flag and it resolved my issue