search

pinellolab / CRISPResso2

Analysis of deep sequencing data for rapid and intuitive interpretation of genome editing experiments
Other
256 stars 91 forks source link

Allele plot doesn't show base letter #420

Closed albustruong closed 2 months ago

albustruong commented 2 months ago

Describe the bug I ran CRISPRessoBatch with the script:

CRISPRessoBatch --batch_settings 20240410.batch \ --amplicon_seq cagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtAggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatggg \ -p 4 --base_editor_output -g aagtaggagcgcgtgatgaacttcg -q 30 -wc -10 -w 20 \ --conversion_nuc_from A --conversion_nuc_to G --place_report_in_output_folder

and received successful analysis. However, the allele plot in the reports doesn't look right where all the letters for the bases just disappear (see photo) 9 Alleles_frequency_table_around_sgRNA_aagtaggagcgcgtgatgaacttcg

Expected behavior How can I show the letters just like a usual allele plot?

kclem commented 2 months ago

Hi @albustruong,

This is a bug introduced by a change in matplotlib. You can fix this by installing an earlier version of matplotlib:

conda install matplotlib=3.7.3

We've also pushed a fix for this in 448d244 which is contained in the latest release (v2.3.0).

I hope that helps!

albustruong commented 2 months ago

Thanks. It works!!!