Closed LinHedehus1 closed 8 months ago
Hi @LinHedehus1,
unfortunately, our servers experienced an unexpected outage over the weekend, leading to a crash in the job queue on CRISPRme's website. We have since identified and resolved the issue, and the server is now fully operational. You are welcome to resubmit your query, and we apologize for any inconvenience caused.
Manuel
Describe the bug Status report Indexing genome(s): Not available Searching spacer: Not available Post processing: Not available Merge targets: Not available Annotating and generating images: Not available Integrating results: Not available Populating database: Not available
The selected result encountered some errors, please remove it and try to submit again
To Reproduce
If running CRISPRme via command line, type the command line call to CRISPRme returning the error
If running CRISPRme via the website, please fill the form below:
Spacer sequences AGACAGATATTTGCATTGAGATA
Cas protein Cas12a
PAM TTTV-23bp-Cas12a
Genome Hg38
Variants dataset (OPTIONAL) plus 1000 Genomes Project variants plus HGDP variants
Thresholds Mismatches: 6 DNA Bulges: 2 RNA Bulges: 2
Base editing (OPTIONAL) Start: 7 Stop: 15 Nucleotide: A
Annotation
Expected behavior I get an error and no results
Screenshots If running CRISPRme via website, add screenshots to help explain your problem.
Environment (please complete the following information, ONLY applicable if running CRISPRme via command line):
Additional context I ran your test dataset with Cas9 and had no issues. I wonder if it has something to do with the Cas12a; I also tried different gRNAs for Cas12a with the same outcome