search

pr2database / pr2-primers

Scripts for paper Vaulot et al. 2022
5 stars 1 forks source link

primers listed in Niwa et al. (2011) #5

Closed frederic-mahe closed 4 years ago

frederic-mahe commented 4 years ago

Niwa et al. (2011) published a list of primer sequences (in supplementary Table S1). I think most of these primers are not yet present in our primer table.

| Primer   | Sequence (5’-3’)         | Targets (source)                  |
|----------+--------------------------+-----------------------------------|
| Pbr1     | GGTTGATCCTGCCAGTAGTC     | SSU rDNA (This study)             |
| Pbr1r    | GACTACTGGCAGGATCAACC     | SSU rDNA (This study)             |
| Pb121    | GGATACAAAAACCAAACCTGGC   | SSU rDNA (This study)             |
| Pb121r   | GCCAGGTTTGGTTTTTGTATCC   | SSU rDNA (This study)             |
| Pbr2r    | CTCTATGCCCGAATCGCTTC     | SSU rDNA (This study)             |
| Pbr4     | GTGTCGCTTAAGATATAGTC     | SSU rDNA (This study)             |
| Pbr4r    | GACTATATCTTAAGCGACAC     | SSU rDNA (This study)             |
| LRP4     | CGTTGGAAGGCGGCATCA       | LSU rDNA (This study)             |
| NDL22f   | CGTCTTGAAACACGGACCA      | LSU rDNA (This study)             |
| NDL22    | TGGTCCGTGTTTCAAGACG      | LSU rDNA (van Tuinen et al. 1998) |
| 28s1     | CCGGAGCTGAAACAGCTT       | LSU rDNA (This study)             |
| 28s1r    | AAGCTGTTTCAGCTCCGG       | LSU rDNA (This study)             |
| 28S3     | GGGGAATCCGACTGTTTAATT    | LSU rDNA (This study)             |
| 28s3r    | AATTAAACAGTCGGATTCCCC    | LSU rDNA (This study)             |
| V282     | GTGGGATAACGGCTGAACG      | LSU rDNA (This study)             |
| P282r    | CGTTCAGCCGTAATCCTAC      | LSU rDNA (This study)             |
| IGS1r    | GTTGATGTGTTGTAAGGGGTATG  | IGS (This study)                  |
| IGSa-10f | GCATCACCTTAGCATTCGTTC    | IGS (This study)                  |
|----------+--------------------------+-----------------------------------|
vaulot commented 4 years ago

Bonjour Fred Thanks for pointing out the paper. I updated the database (I will refresh latter the Wiki files). Some of these primers seem very specific as they are targetting the introns within the 18S).

frederic-mahe commented 4 years ago

Some of these primers seem very specific as they are targeting the introns within the 18S).

You are right, the paper targets ribosomal intron/exon polymorphism in Plasmodiophora brassicae. However, I was hopping that some of the primers were universal enough to appear in our database.

vaulot commented 4 years ago

No problem, I added them since it is better to have as much info as possible and maybe we will have a fan of Plasmodiophora brassicae