More fungi-specific 18S primers

[frederic-mahe]

I've seen these primers used in several studies, so you might want to consider including them in the 18S primer database. The original publication seems to be:

Vainio EJ, Hantula J (2000) Direct analysis of wood-inhabiting fungi using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Mycol Res 104: 927–936. https://doi.org/10.1017/S0953756200002471

From table 2 in Vainio & Hantula (2000):

FF390: CGATAACGAACGAGACCT FF700: GATACCGTNGTAGTCT FF1100: CCAGCTCCAATAGCGTATATTA

FR1: ANCCATTCAATCGGTANT (reverse)

Note that, in the original publication, primer sequences contain inosine (I) symbols. I've replaced them with Ns.

[vaulot]

Thanks a lot Fred, I have added them to the database. Which combination has been used for metabarcoding in recent studies (with the citation if you have).

[frederic-mahe]

Sure, the original paper tested the primer pairs FF390-FR1, FF700-FR1, and FF1100-FR1.

That 2019 preprint used:

FF390 and FR1 for V7-V8 region of 18S rRNA amplicons.

They cite a 2015 paper:

Similarly, an 18S rRNA gene fragment of about 350 bases was amplified using the primers FR1 (5′‐ANCCATTCAATCGGTANT‐3′) and FF390 (5′‐CGATAACGAACGAGACCT‐3′)

Which cites a 2011 paper:

The primer set FR1 (5′-AICCATTCAATCGGTAIT-3′) / FF390 (5′-CGATAACGAACGAGACCT-3′) was developed by Vainio and Hantula.

[vaulot]

Merci Fred, added to the database....